Lagartija topo cuatro dedos (Bipes canaliculatus)

Lagartija topo cuatro dedos (Bipes
canaliculatus)
N omb res comu n es: Four-toed worm lizard (Inglés)
Si n ón i mos: Bipes alvarezi, Lacerta sulcata, Lacerta mexicana, Lacerta lumbricoides, Chamaesaura propus, Chirotes
canaliculatus
   


¿Tienes alguna duda, sugerencia o corrección acerca de este taxón? Envíanosla y con gusto la
atenderemos.
Foto: (c) juanbgodoy9, algunos derechos reservados (CC BY-NC)
Ver todas las fotos etiquetadas con Bipes canaliculatus en Banco de Imagénes »
Descripción de EOL Ver en EOL (inglés) →
Range description 1,2
This species is endemic to the Balsas-Tepalcatepec Basin in the States of Guerrero and Michoacan in
Mexico. While it has yet to be recorded from Puebla State or the northeastern limits of the Balsas basin,
it is possible that the species occurs throughout the Rio Balsas Basin. The elevational limit is not
recorded here.
Type information 3
Paratyp e for Bipes canaliculatus
Catal og N u mb er: USNM 67595
Col l ecti on : Smithsonian Institution, National Museum of Natural History, Department of Vertebrate
Zoology, Division of Amphibians & Reptiles
Prep arati on : Ethanol
Local i ty: Tecuaiziapan (= Tecuiciapa), Guerrero, Mexico
Habitat and ecology 1,2
Hab i tat an d Ecol ogy
This fossorial species is associated with rocky soils and loose gravel, and may be found in rotten logs or
under rocks. It seems to be a tropical dry forest species, but as with other members of the genus Bipes
it may be present in disturbed areas used for agriculture.
Systems
Terrestrial
Barcode data: bipes canaliculatus 4
The following is a representative barcode sequence, the centroid of all available sequences for this
species.
There are 4 barcode sequences available from BOLD and GenBank.
Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member
of the species.
See the BOLD taxonomy browser for more complete information about this specimen and other
sequences.
GTGTCATTCACCCGCTGATTTTTCTCCACAAACCACAAAGACATCGGCACGCTGTACTTGGTCTTCGGTGCCTGGGCCGGAGC
-- end -Download FASTA File
Iucn red list assessment 1,2
R ed Li st Category
LC
Least Concern
R ed Li st Cri teri a
Versi on
3.1
Year Assessed
2007
Assessor/s
Ponce-Campos, P. & Garca Aguayo, A.
R evi ewer/s
Cox, N., Chanson, J.S. & Stuart, S.N. (Global Reptile Assessment Coordinating Team)
Con tri b u tor/s
Ju sti fi cati on
Bipes canaliculatus is endemic to Mexico, occurring in the Central Pacific Coast region. Its known extent
of occurrence is less than 20,000 km, however, this is a fossorial species and is likely to be more
widespread than currently known. It is not thought to be under any significant threat at present.
Population 1,2
Pop u l ati on
It is believed to be reasonably common, although the fossorial habits of this species can make it difficult
to find.
Pop u l ati on Tren d
Stable
Threats 1,2
M aj or Th reats
There appear to be no major threats to this species.
Conservation actions 1,2
Con servati on Acti on s
Although populations of this species are not know to occur in any protected areas, B. caniculatus is
protected by Mexican national legislation (listed under the Pr category (special protection). Further
research is needed to determine the full extent of the species range.
References
1. Ponce-Campos, P. & Garca Aguayo, A. 2007. Bipes canaliculatus. In: IUCN 2014 . IUCN Red List of
Threatened Species. Version 2014.1 . <www.iucnredlist.org>
2. © International Union for Conservation of Nature and Natural Resources, some rights reserved
3. © Smithsonian Institution, National Museum of Natural History, Department of Vertebrate
Zoology, Division of Amphibians & Reptiles, some rights reserved
4. © Barcode of Life Data Systems, some rights reserved