Trabajo práctico: código genético y síntesis de proteínas

advertisement
Trabajo práctico: código genético y síntesis de proteínas
¿A qué nos referimos cuando hablamos de “código genético”?.
Explica por qué se caracteriza al código genético como universal y degenerado.
Define codón y anticodón.
El siguiente texto refiere a las tres etapas que caracterizan al proceso de
traducción. Completa según corresponda utilizando los términos ofrecidos a
continuación.
Aminoácido iniciador/ Peptidil transferasa/ A /Codón de iniciación /Factor de
elongación / Anticodón / Menor / ARNm / Factores de liberación / Codón de
terminación / Menor / Peptídico / Factores de iniciación.
1)
2)
3)
4)
La síntesis de proteínas puede dividirse en tres etapas:
Iniciación:
La síntesis de proteínas comienza cuando la subunidad __________del
ribosoma se une al extremo 5’ del ________. Para que ello ocurra, se requieren de
proteínas que se localizan en la subunidad menor y se conocen como _____________.
La subunidad _____________ se desliza sobre el ARNm, hasta localizar el
_________________ que quedará ubicado en el sitio P. Luego, el primer ARNt se
aparea por su _____________, en forma antiparalela, con el codón de iniciación. En el
dominio opuesto al anticodón, el ARNt porta el ______________ que será el primero
que conformará la proteína. Mediante ésta unión (codón - anticodón) quedará
establecido el marco de lectura de los sucesivos codones.
Posteriormente, se liberan los factores de iniciación y la subunidad ribosómica mayor
se acopla a la subunidad menor.
Elongación:
La elongación comienza cuando un segundo ARNt ingresa al sitio _____
del ribosoma, de acuerdo a la secuencia establecida por el ARNm. Pero, para que ello
ocurra, éste segundo ARNt debe unirse primero a una proteína conocida como
_____________ que, luego de la unión, se libera.
Cuando los dos sitios A y P ya han sido ocupados por los correspondientes ARNt, una
enzima denominada _________________ localizada en la subunidad mayor, cataliza la
formación de un enlace __________ entre los dos aminoácidos. Posteriormente, el
primer ARNt se libera y el ribosoma se corre dejando el sitio A libre para el ingreso de
un tercer ARNt.
Terminación:
Cuando el ribosoma alcanza un _______________, no existe ningún
ARNt cuyo anticodón pueda aparearse con estos codones. De esta manera, el sitio A
quedará vacío y es ocupado rápidamente por __________________, se detiene la
traducción, el polipéptido se desprende y se separan las dos subunidades ribosómicas.
5) Resuelve los siguientes problemas de opción múltiple:
a) Un RNA mensajero tiene 336 nucleótidos de longitud, incluyendo los codones
de iniciación y terminación. El número de aminoácidos de la proteína traducida
a partir de este ARNm es:
- 999
- 630
- 330
- 111
- 110
b) ¿Qué ARNm codifica para la siguiente proteína?
Met-Arg-Ser-Leu-Glu.
- 3´AUGCGUAGCUUGGAGUGA 5´
- 3´AGUGAGGUUCGAUGCGUA 5´
- 5´AUGCGUAGCUUGGAGUGA 3´
- 1´AUGCGUAGCUUGGAGUGA 3
- 3´AUGCGUAGCUUGGAGUGA 1´
c) Bajo condiciones donde La Metionina debe ser el primer aminoácido, ¿Qué proteína
estará codificada por el siguiente ARNm?
5´- CCUCAUAUGCGCCAUUAUAAGUGACACACA – 3´
-
Pro – His – Met – Arg – His – Tyr – Lys – Cys – His – Thr.
Met – Arg – His – Tyr – Lys – Cys – His – Thr
Met – Arg – His – Tyr - lys
Met - Pro – His – Met – Arg – His – Tyr – Lys – Cys – His – Thr
d) Se usa un ARNm sintético de secuencia repetitiva 5´- CACACACACACACA.....
en un sistema sintetizador de proteínas, en ausencia de células. Asumiendo que la
síntesis de proteínas pueda comenzar sin la necesidad de un codón de iniciación ¿Qué
producto o productos pueden esperarse tras la síntesis de proteínas?
- Una proteína compuesta por un solo tipo de aminoácido.
- Tres proteínas, cada una compuesta por un único tipo de aminoácido diferente.
- Dos proteínas, cada una con una secuencia alternada de dos aminoácidos
diferentes.
- Una proteína, con una secuencia de tres aminoácidos alternantes diferentes.
- Una proteína, con una secuencia de dos aminoácidos alternantes diferentes.
Descargar