Subido por Juan José Garzón

Quimioterapia antiviral a comienzos del siglo XXI

Anuncio
ÁMBITO FARMACÉUTICO
FARMACOLOGÍA
Quimioterapia antiviral a comienzos
del siglo XXI
EUGENIO URIARTE VILLARES
Profesor Titular de Química Farmacéutica. Facultad de Farmacia. Universidad de Santiago de Compostela.
Las infecciones producidas por virus se encuentran entre aquellas más
difíciles de tratar y en las que sólo muy recientemente se está obteniendo
un cierto éxito. Con seguridad, los próximos años serán muy fructíferos
en este campo y por eso resulta interesante hacer una descripción de
los fármacos antivirales de que se dispone en el umbral del nuevo siglo
y los caminos que se vislumbran. Éstos se tratan agrupados por
su capacidad de interacción sobre la/s membrana/s o el genoma viral,
con una organización en función de su estructura molecular,
que se relaciona con el mecanismo por el que actúan.
L
os virus son ácidos nucleicos
rodeados por una cubierta proteica, son entonces «paquetes de
información genética», que se
introducen en una célula huésped
y dirigen la maquinaria metabólica de esta para producir más virus,
siendo por ello parásitos obligados.
En el medio extracelular los virus
son inactivos y presentan la morfo80 OFFARM
logía característica del grupo al
que pertenecen, en este estado se
habla de partícula viral o virión.
La estructura básica de un virión
es un ácido nucleico —puede ser
ADN o ARN (nunca ambos) y
bicatenal o monocatenal— rodeado por una proteína (cápside) y a
veces por una membrana (envoltura) en cuya composición participan
lípidos, hidratos de carbono y proteínas. Los virus que carecen de
esta envoltura, se llaman «virus
desnudos»1. Estos sencillos aspectos
comentados nos hacen ver la simplicidad, pero también la variabilidad con que podemos encontrarnos.
En este trabajo se describe la quimioterapia antiviral disponible
para virus capaces de producir
ABRIL 2001
FARMACOLOGÍA
Con envoltura
Herpesviridiae (HSV-1 y 2, CMV,
virus Epstein-Barr)
Hepadnaviridae (hepatitis B)
Bicatenario
Desnudo
ADN
Papovaviridae (VPH)
Adenoviridae
Monocatenario
Desnudo
Parvoviridae
Bicatenario
Desnudo
Reoviridae
Flaviviridae (hepatitis C,
fiebre amarilla)
Con envoltura
ARN
Togaviridae (ruebola)
(+)
Desnudo
Monocatenario
Retroviridae (VIH, leucemia)
Picornaviridae (hepatitis A,
poliovirus, coxsackie)
ta. La metisazona (fig. 2) fue el
primer antiviral ensayado extensamente en humanos, se hizo al inicio
de la década de los sesenta en la
India y frente a ADN-virus. En
cualquier caso, de estas primeras
moléculas se mantienen prácticamente sólo los análogos de nucleósidos, que son ampliamente utilizados en la actualidad y que se describirán con detalle.
Para tratar de organizar el estudio del conjunto de los fármacos
antivirales disponibles, considero
oportuno establecer una clasificación básica que los diferencie por
el modo de cómo afectan a los dos
componentes esenciales de los
virus, y utilizar después un criterio
de estructura, que obviamente
definirá su mecanismo de acción:
– Fármacos que interfieren sobre
componentes de membrana. Funda(–)
Con envoltura
mentalmente influirán sobre las
Paramyxoviridae (sarampión, RSV)
fases de introducción —adsorción,
Filoviridae (Ébola, Marburg)
penetración y descapsidación— y
también sobre las fases de maduración y liberación.
– Fármacos que interfieren sobre el
Fig. 1. Tipos principales de virus causantes de enfermedades humanas.
genoma viral. Fundamentalmente
influirán sobre los mecanismos de
enfermedades en humanos2, nom- decir que fue en las décadas de los replicación.
brados siguiendo las normas esta- sesenta y setenta cuando aparecieblecidas por el Comité Internacio- ron los primeros compuestos actinal de Taxonomía de los Virus vos, pero realmente el desarrollo Fármacos que intervienen sobre
(ICTV) creado en 1966 (fig. 1) y de este tipo de quimioterapia tiene componentes de membrana
no tratará de vacunas3. Los mayo- lugar en la última década.
Las primeras moléculas descritas Los componentes de membrana
res problemas con que nos encontramos al tratar de establecer una con actividad antiviral fueron las van a tener importancia, en primer
tiosemicarbazonas, que eran estu- lugar porque van a ser los sistemas
quimioterapia antiviral son:
diadas por su actividad antimicro- de reconocimiento del virus por la
– Los virus, al tener una consti- biana a finales de los años cincuen- célula huésped y los que permitan
tución tan simple, no ofrecen
su entrada en ella, y también porgrandes posibilidades de puntos de
que finalmente va a ser necesario
ataque.
reconstruir esta membrana, en el
– Al tener que producirse su
proceso de maduración, para geneS
proliferación a expensas de la célurar el virión que ha de liberarse. En
NH2
la huésped, es difícil establecer
muchas de estas fases se encuentran
una acción específica.
dianas terapéuticas, y muchas de
NH
– Al producirse la primera sintoellas están en desarrollo, pero se
N
matología cuando ya se superó un
comentan casi exclusivamente
punto límite, los fármacos al uso
aquellas para las que actualmente
son menos efectivos, y aquellos
se dispone de fármacos de uso clímás interesantes serían los prevennico.
tivos.
O
Inhibidores de la adsorción
A todo esto hay que añadir que
En el caso del virus de la inmunoNH
hasta mediados de los años cindeficiencia humana (VIH), por
cuenta no era posible el ensayo de
ejemplo, la adsorción se realiza
nuevas moléculas en sistemas de
porque se produce un reconocicultivo celular 4 . Así, podemos Fig. 2. Metisazona.
miento gp120 del virus-receptores
Orthomyxoviridae (influenza virus)
ABRIL 2001
OFFARM
81
FARMACOLOGÍA
CD4 de la membrana de los linfocitos T, de modo que una estrategia terapéutica fue dirigida a
impedir ese proceso:
NH2
– Análogos de CD4. Aunque se
dispone de buenos, presentan problemas importantes porque los
receptores CD4 no son solo receptores para los virus.
– Inhibidores del complejo de interacción gp120-CD4. Se conocen
diversas moléculas, que además,
como no hacen el bloqueo de
manera demasiado específica, tienen actividad también frente a Fig. 3. Amantadina (izquierda) y rimantadina.
otros tipos de virus con envoltura:
– Polisulfatos de polisacáridos.
– Polisulfonatos. Un prototipo es
OH
la suramina, que fue la primera
OH
CO2H
molécula reconocida como anti-VIH
y el primer fármaco usado para el
tratamiento del sida5, aunque penH
O
O
N
sando erróneamente que era inhibiR
dor de transcriptasa inversa (TI).
OH OH
– Ciertos complejos metálicos.
O
NH2
H3C
OH
OH
O
H
N
CO2H
OH OH
O
Inhibidores de la penetración-descapsiÁcido N-acetilneuramínico
Estado de transición de la ruptura
dación
mediada por neuraminidasa
Los derivados del adamantano (fig.
3) son fármacos de este tipo porque impiden la entrada del virus
en la célula huésped al bloquear la
descapsidación del virus. Tienen
OH
OH
utilidad contra el virus de la gripe:
La hemaglutinina viral «reconoOH
CO2H
O
OH
ce» al ácido siálico presente en la
H
membrana de la célula que va a ser
N
CO2H
O
atacada y el virus es introducido.
H
OH NH
Posteriormente se forma un canal
N
iónico (M2) en la cubierta viral,
O
NH
OH NH2
que permite la entrada de protones
y cuando el pH baja, se inducen
O
NH2
cambios —hidrólisis ácida— en la
Zanamivir
hemaglutinina, que permite la
liberación del genoma viral. Estos
compuestos, bloquean el canal
M2, impidiendo así el desnudamiento viral. A concentraciones
más altas, hay también procesos de
´R
interferencia en la liberación.
O
O
CO2H
CO2H
La amantadina (1-aminoadamanH
H
tano) se introdujo en 1966 y no
N
N
fue muy utilizada debido a su
NH2
NH2
limitado efecto, a los problemas
sobre el SNC (mareos, insomnio) y
O
O
el SNA —tiene también un limitado uso como antiparkinsoniano
Oseltamivir
por su efecto anticolinérgico— y a
la aparición de resistencias.
La rimantadina se introdujo en Fig. 4. Fármacos inhibidores de la neuraminidasa del virus de la gripe al mimetizar
clínica en 1994, siendo su dosis el estado de transición que provoca.
82 OFFARM
ABRIL 2001
FARMACOLOGÍA
absorción por vía oral y por ello se
administra por vía respiratoria.
R=H
Fenilalanina
Como se observa en la figura 4,
en el estado de transición de la
R = OH Tirosina
Prolina
ruptura del ácido N-acetilneuramínico por la enzima, el ciclo es
O
O
casi planar en el entorno del átomo
H
HO O –
de oxígeno, como resultado de la
N
H
H
N
tensión originada en el ciclo de
N
+
azúcar durante ese estado de tranN
sición (a ello contribuyen también
las fuertes interacciones iónicas
entre el grupo carboxilo y tres
residuos de arginina del sitio de
R
Estado de transición
reconocimiento y el doble enlace
Sustrato
formado). Esta conformación se
mimetiza bien con un anillo de
ciclohexeno, en el que el doble
enlace se sitúe hacia la posición
HO
que ocupaba en el ciclo el átomo
H
O
N
de oxígeno. Derivados del cicloheHN
+
xeno son estructuras más estables e
incluso más versátiles desde el
punto de vista químico y sintético.
En uso clínico muy reciente se
encuentra también el oseltamivir
(fig. 4). El grupo pentiloxi de la
posicion 3, además de aumentar su
Fig. 5. Estructura del estado de transición de la ruptura mediada por la proteasa
lipofilia y hacer el compuesto
del VIH, que se trata de mimetizar en los fármacos inhibidores de esta enzima.
absorbible por vía oral, se aloja en
un área hidrofóbica del receptor,
necesaria aproximadamente la la neuraminidasa, que hidroliza por lo que mejora sus característimitad que de amantadina y no pre- esos ácidos siálicos terminales y cas de enlace6.
senta tantos problemas secundarios. permite su entrada en la célula.
Dentro de los inhibidores de la Esta neuraminidasa viral es necesa- Fármacos que impiden la maduración
penetración, podemos incluir tam- ria también para la liberación del Son fármacos que actúan después
bién como fármacos de reciente virus una vez formado en el inte- de que todos los componentes del
uso clínico para el tratamiento del rior de la célula.
virión hayan sido ya sintetizados
virus de la gripe, los inhibidores
Ambas proteínas virales en el por la célula huésped, pero que
de neuraminidasa6 aunque también caso del virus de la influenza consiguen impedir que se ensampodrían ser considerados, como se (hemoglutinina y neuraminidasa) blen adecuadamente.
hace en algunas monografias, fár- fueron determinadas por rayos X
macos inhibidores de la liberación. en su interacción con sus recepto- Inhibidores de la proteasa del VIH5b
Los glicoconjugados (glicoproteí- res y ello las convierte —especial- Una aspartil-proteasa codificada
nas y glicolípidos) son elementos mente a la neuraminidasa— en por un gen viral pol (el gen pol
de membrana de todas las células elementos muy útiles para el dise- codifica enzimas: proteasa, intede vertebrados y actúan como ño racional de inhibidores que grasa, ribonucleasa, TI) es la resligandos de reconocimiento de puedan dar lugar a fármacos anti- ponsable de la ruptura de proteíproteínas sean internas o externas virales (fig. 4).
nas precursoras codificadas por el
(por ejemplo, para el reconociLa sustitución del hidroxilo de la gen viral gag (gag codifica las promiento de patógenos). Estos glico- posición 4 del ácido N-acetilneu- teínas de estructura) para dar lugar
conjugados en células de mamífe- ramínico, por un grupo amino, a las proteínas maduras, y su inhiros terminan generalmente por incrementó mucho la potencia bición podría causar grave daño
ácidos siálicos, entre los que el más inhibidora de la neuraminidasa viral. Esta es una estrategia que se
importante es el ácido N-acetil- (aproximadamente 200 veces), y la está desarrollando extensivamente
neuramínico. El virus de la influen- sustitución por un grupo guanidino porque estas proteínas son del tipo
za infecta células porque se une a (aproximadamente 5.000 veces). de otras aspartil-proteasas humaesos ácidos siálicos de superficie Además, el zanamivir resultó un nas ya conocidas (renina).
utilizando una proteína viral de millón de veces más potente en su
Por otra parte, los puntos de
enlace, la hemaglutinina. El virus unión a la neuraminidasa del virus ruptura de esta proteasa viral fuenecesita también una «enzima des- que el propio ácido N-acetilneura- ron identificados, presentando
tructora de receptor», en este caso mínico. Su hidrofilia dificulta su alta especificidad por las uniones
84 OFFARM
ABRIL 2001
FARMACOLOGÍA
[Tyr-Pro] y [Phe-Pro], lo que fue
usado para el diseño de inhibidores
apropiados. Para ello fue seguido
el principio de «peptidomiméticos
del estado de transición» y tratando de reemplazar la unión peptídica hidrolizable por un isóstero no
hidrolizable de ese estado de transición (fig. 5).
Fueron sintetizados y estudiados
varios inhibidores de la proteasa
del VIH conteniendo un isóstero
del estado de transición hidroxietilamínico y varios de ellos son de
uso clínico en la actualidad (fig. 6),
normalmente en terapia combinada con los más clásicos análogos de
nucleósidos.
Este tipo de fármacos de tipo
peptídico presenta generalmente
una corta vida media (debido a la
acción de enzimas proteolíticas) y
pobre absorción por vía oral. En
muchos casos tratan de «enmascararse» (eliminando grupos hidroxilos, incluyendo grupos lipófilos u
obteniendo profármacos) cuando ello
es posible. De todas formas, se están
haciendo esfuerzos diferentes a esta
aproximación peptídica, y una de las
más importantes es la de ureas cíclicas no peptídicas, entre las cuales
podemos considerar al XM323 (fig.
7) como un cabeza de serie y fármaco en fase clínica de estudio con
buena absorción por vía oral.
O
NH2 OH
H
N
O
N
N
H
O
O
N
O
S
OH
H
N
O
N
H
O
H
N
CH3
S
N
N
O
Ritonavir
OH
O
OH
N
N
N
N
H
O
NH
Indinavir
OH
CH2
H
N
OH
N
O
O
Fármacos que impiden la miristoilación
S
O NH
O
Las proteínas virales necesitan ser
finalmente miristoiladas para que
los viriones sean maduros. El ácido
mirístico se une al N de una glicina
Nelfinavir
terminal mediante una N-miristoiltransferasa. Se conocen varios
inhibidores de la miristoilación
pero todos a tan alta concentración
que no tienen utilidad terapéutica. Fig. 6. Fármacos inhibidores de la proteasa del VIH.
86 OFFARM
NH
Saquinavir
O
Fármacos que impiden la glicosilación
La glicosilación necesaria para la
formación de las glicoproteínas de
la cápside y de la envoltura, en su
caso, es un proceso que también ha
sido tomado como diana de la
intervención farmacológica, aunque hasta el momento no ha dado
resultados terapéuticos. Se trata en
general de aminoazúcares, que se
comportan como azúcares falsos,
que además, pueden introducirse
en análogos de nucleósidos difosfatados de unas características estéri-
N
cas parecidas y menor polaridad
que los transportadores normales,
por lo que estaría facilitado su
paso al citoplasma celular (fig. 8).
Fármacos que intervienen
sobre el genoma viral
El grupo de fármacos antivirales
que actúan interfiriendo sobre el
genoma viral es en la actualidad el
más numeroso, y también en el
H
N
OH
N
NH2
S
O
O
Amprenavir
que hay una diferencia más clara
entre los distintos tipos de virus,
especialmente los retrovirus como
el VIH, y los demás. Específicamente existe en los retrovirus la
transcriptasa inversa, que es diana
del más importante grupo de fármacos anti-VIH.
En general son antimetabolitos,
es decir, análogos de metabolitos
naturales, que por similitud estructural los sustituyen e impiden que
cumplan su función.
ABRIL 2001
FARMACOLOGÍA
O
HO
las funciones de los nucleósidos
naturales, interfiriendo con los
procesos de traducción y/o transcripción en los que están implicados.
Las modificaciones estructurales
que pueden producirse son esquemáticamente de tres tipos: sobre la
base, sobre el azúcar y sobre el modo
de unión entre la base y el azúcar
(fig. 10). De los miles de nucleósidos sintetizados, solo unos pocos
están utilizándose actualmente en
clínica (aunque muchos otros presentan también interesante actividad antiviral —también anticáncer— in vitro y/o in vivo), y es a los
que se hará referencia.
El primer análogo de nucleósido
antiviral utilizado en terapia fue la
5-yododesoxiuridina (fig. 11). Es
un análogo estructural de la desoxitimidina en el que el grupo
metilo de esta se sustituye por un
átomo de yodo (radio de Van der
Waals del metilo y del yodo: 2,00
y 2,15 Å, respectivamente), y por
lo tanto actúa como su antimetabolito, fosforilándose e incluyéndose en el ácido nucleico que se
está formando de manera errónea.
En la actualidad se utiliza en el
tratamiento tópico de queratoconjuntivitis producida por herpes-
OH
N
N
HO
OH
Fig. 7. XM323.
hidrólisis del pirofosfato y se bloquea la polimerización.
Análogos de pirofosfato
Moléculas que pueden ocupar el sitio
de unión del pirofosfato en el ADN
o ARN-polimerasa, impidiendo
por ello su función (fig. 9).
El foscarnet (sal trisódica del
ácido fosfonofórmico) (fig. 9) inhibe la polimerasa viral 100 veces
más que la polimerasa celular.
Cuando el trifosfato de nucleótido
se une a la polimerasa, el fragmento pirofosfato se rompe y el monofosfato se une a la cadena de ADN
o al ARN que está en fase de polimerización. Si sobre la polimerasa
no hay sitio para aceptar el pirofosfato porque ese sitio está ocupado por el fármaco, no se produce la
Análogos de nucleósidos
Los nucleósidos son componentes
de los ácidos nucleicos (y también
de otras macromoléculas bioquímicas), compuestos por un azúcar, ribosa o desoxiribosa según sea ARN o
ADN, respectivamente, y una base
heterocíclica púrica —adenina, guanina— o pirimidínica —citosina,
uridina o timina— según se trate
de ARN o ADN (fig. 10).
Es entonces fácil imaginar cómo
análogos de estos nucleósidos
pueden comportarse cómo antimetabolitos y modificar o anular
OH
OH
HO
O
O
O
O P
OH
N
O P O
O–
Castanospermina
B
O
O–
7,74 Å
HO
OH
Pirofosfato
O
OH
OH
HO
N
CH2OH
CH2–CH2–CH2–CH3
(NBuDNJ)
N-Butil-1-deoxinojerimicina
O
O
O C N
H
S O
O
B
O
Azúcar falso
7,18 Å
HO
OH
Oxicarbonilaminosulfonilo
Fig. 8. Aminoazúcares que pueden comportarse como azúcares falsos en el proceso de glicosilación (izquierda) y asociación de éstos
con falsos dinucleótidos transportadores (derecha).
88 OFFARM
ABRIL 2001
FARMACOLOGÍA
virus humano (HVH) la trifluridiO
O
na (5-trifluormetildesoxiuridina)
(fig. 11), que sigue siendo un anáHO P O P OH
logo directo de los citados (radio
de Van der Waals del grupo triOH
OH
fluormetil, 2,44 Å). Este compuesPirofosfato
to es más activo que la 5-yododesoxiuridina puesto que al ser el
grupo trifluormetil peor grupo
saliente que el yodo, bloquea en
mayor medida la timidino sintetasa (fig. 11), pero mantiene el principal problema de la falta de selectividad (especificidad), puesto que
O
O
tampoco su activación es estrictamente dependiente de la quinasa
HO P A C OH
del virus, y afecta entonces en gran
medida a la célula huésped.
OH
Fue importante el descubrimiento de que el 5-etil derivado, es
decir, un homólogo superior de la
desoxitimidina, presentaba cierta
actividad citotóxica en células infectadas por el HVH y sin embargo, Fig. 9. Fármacos análogos de pirofosfato.
HO
O
O
P
C C
H2
OH
OH
Fosfonoacético
O
HO
CO2H
P
OH
Foscarnet
Pirimidínicos
Uracilo
Citosina
NH2
5
N
HO
5´ 6
O
N
Timina
O
O
3
NH
4
1
N
4´
O
O
H3C
2
HO
O
O
N
O
1´
3´
2´
OH OH
Citidina
NH
OH
Uridina
Timidina
Púricos
7
N
O
6
5
8
N
Adenina
NH2
4
9
Adenosina
N
Guanina
O
N
N1
N
2
O
NH
N
NH2
Guanosina
Fig. 10. Estructura de los nucleósidos componentes de los ácidos nucleicos y numeración habitualmente utilizada.
ABRIL 2001
OFFARM
89
FARMACOLOGÍA
O
O
HN
HO
O
HN
I
O
HO
N
O
O
HO
CF3
N
HO
5–yododesoxiuridina
Trifluridina
O–
O
O
I
I
HS-E
H
O
O
CH2-THF
m-THF
I
H
O
S-E
S-E
Fig. 11. Fármacos análogos de desoxitimidina (superior) y mecanismo de acción de la timidino sintetasa (inferior).
no en células sanas. Fue una confirmación de que las quinasas virales
eran menos específicas (más fáciles
de engañar, es decir, fosforilan más
fácilmente sustratos diferentes de
aquellos normales) que las quinasas
de las células huésped. Esto permite extraer una conclusión importante: para conseguir un antimetabolito antiviral lo más eficaz (con
O
O
HN
HO
O
O
HN
Br
O
HO
N
O
HO
HO
HO
Brivudina
Sorivudina
NH2
N
HO
O
HO
N
N
N
HO
Adenosina arabinósido
Fig. 12. Brivudina, sorivudina y adenosina arabinósido.
90 OFFARM
N
Br
el mayor índice terapéutico) posible, es necesario apartarse lo más
posible de la estructura del metabolito.
Se prepararon así, la brivudina,
con un grupo bromovinilo en la
posición 5 del uracilo, y más recientemente la sorivudina (análogo arabinósido) (fig. 12), que está en fase
clínica avanzada para el tratamiento
de HVH. Este es el más potente
inhibidor conocido de varicela-zoster-virus (VZV). En los primeros
ensayos clínicos del fármaco sucedieron varios casos de muerte aparentemente relacionadas con el uso
del mismo. Posterior investigación
detectó que los pacientes muertos
habían sido tratados simultáneamente con 5-fluorouracilo (5-FU,
antitumoral). El problema está en
que el 5-FU se metaboliza mediante
la uracil reductasa y la sorivudiva se
hidroliza primero liberando el 5-bromoviniluracilo, que es un potente
inhibidor de la uracilo reductasa,
por lo que los niveles del altamente
citotóxico 5-FU resultaban exageradamente aumentados (es preciso llamar la atención sobre estos aspectos
en las situaciones de combinación
de fármacos).
La adenosina arabinósido (fig.
12) fue el primer fármaco antiviral
ABRIL 2001
FARMACOLOGÍA
utilizado para uso sistémico. Tiene
baja biodisponibilidad oral por lo
que se administraba por vía intravenosa y se degrada (hidrólisis del
grupo amino de la posición 6 del
O
anillo de purina) muy rápidamente
por la adenosina deaminasa.
NH2
N
Entre los análogos de nucleósido
que presentan una modificación
drástica del esqueleto de la base
N N
HO
O
heterocíclica, tiene un lugar desta- HO
cado la ribavirina (fig. 13), con un
anillo de triazol sustituido por un
grupo carboxamido en la posición
OH OH
3 del mismo, que es la apropiada
para mimetizar las posiciones 5 y
6 de la inosina (hipoxantina). Su
mecanismo de acción parece más
complejo que el de otros análogos Fig. 13. Rivabirina (izquierda) y iosina.
y aún no perfectamente conocido.
Cuando este sustrato se fosforila,
su monofosfato inhibe la inosina
monofosfato (IM) deshidrogenasa,
que es necesaria para la conversión
O
de IM en xantina monofosfato, la
N
cual se requiere para la síntesis de
NH
guanosina trifosfato (GTP). Por
N
otra parte, su trifosfato puede HO
N
NH2
O
inhibir ARN polimerasas virales.
Es un compuesto que muestra
Aciclovir
amplia actividad frente a gran
variedad de virus ARN y ADN,
pero con un específico uso en el
tratamiento del virus sincitial respiratorio (VSR).
O
El descubrimiento del aciclovir
N
(1974, aunque su uso clínico se
NH
desarrolló en los años 80) fue de
N
un gran impacto porque resultó el
HO
N
NH2
O
primer inhibidor selectivo de
HVH, de tal manera que disminuye drásticamente su actividad frenOH
te a otros tipos de viriasis, pero
también es esencialmente inerte
Ganciclovir
para las células del huésped.
La diana molecular es el ADN
polimerasa viral, que confunde el
trifosfato de aciclovir con dGTP y
O
lo incorpora a la cadena de ADN
viral que está formando. Como en
N
NH
su estructura falta el grupo hidroxilo de la posición 3’, bloquea la
N
N
posterior prolongación de la cade- HO
NH2
na de ADN, considerándose un
«terminador de cadena» (esto establece una adicional seguridad: este
OH
análogo nunca puede formar parte,
Penciclovir
como una mutación, de un ADN
maduro).
La activación del aciclovir necesita tres fosforilaciones sucesivas,
que realizan tres quinasas. La pri- Fig. 14. Aciclovir, análogos y profármacos.
92 OFFARM
O
N
NH
N
O
N
OH OH
O
N
O
O
O
NH
N
N
NH2
NH2
Valaciclovir
N
O
N
O
N
N
NH2
O
O
Famciclovir
ABRIL 2001
FARMACOLOGÍA
mera debe de convertir el aciclovir
en su monofosfato y es una quinasa
viral, que está ausente en las células no infectadas.
El gran perfil de seguridad que
ofrece este fármaco lo lleva a ser
muy utilizado sobre todo en
pacientes inmunodeprimidos, trasplantados, personas afectadas de
cáncer, otras infecciones en personas
con sida, presentando incluso un
interés profiláctico.
El descubrimiento y el desarrollo
del aciclovir estimuló mucho el
esfuerzo en el área de los aciclonucleósidos, obteniéndose varios éxitos posteriores (fig. 14):
NH2
N
N
O O
HO
N
N
P
OH
HO
HO
Ácido fosfoacético
HO
DHPA
NH2
N
N
O
HO
P
HO
N
– Ganciclovir. Con un perfil farmacológico bastante distinto del
aciclovir a pesar de su similitud
estructural, ya que es activo frente
a citomegalovirus (CMV) y mucho
menos selectivo (con mucho
menor margen terapéutico), produciendo fundamentalmente problemas de supresión de médula
ósea.
– Penciclovir. Su perfil farmacológico vuelve a ser más parecido al
aciclovir, a pesar de ser un paso
más en la diferenciación estructural. El trifosfato de penciclovir
tiene una larga vida media, por lo
que su administración puede ser
menos frecuente que en el caso del
aciclovir.
N
O
HO
HPMPA
NH2
NH2
N
N
O
HO
P
N
O
N
O
HO
N
O
O
HO
HO
HPMPC
P
O
O
cHPMPC
Existen también los profármacos, con un interés fundamental de
biodisponibilidad:
Fig. 15. Fosfonatos de aciclonucleósidos.
NH2
N
O
NH2
N
N
O
HO
P
HO
N
P
O
O
O
N
O
N
O
O
Fig. 16. PMEA (izquierda) y Bis (POM)-PMEA.
94 OFFARM
N
O
O
N
– Valaciclovir (L-valil éster del
aciclovir), tiene la ventaja de que
cuando se administra por vía oral,
se hidroliza muy rápidamente en
aciclovir y el aminoácido esencial
L-valina, y los valores del fármaco
en plasma alcanzan 3-5 veces el
nivel de la administración del fármaco solo.
– Famciclovir (diacetil éster del
penciclovir). En 1978 se publica
un nuevo nucleósido, la (S)-9-(2,3dihidroxipropil) adenina (DHPA),
que es el primer aciclonucleósido
con amplio espectro antiviral.
Muestra ser inhibidor de la (S)
adenosilhomocistein-hidrolasa, y
por lo tanto particularmente inhibidor de virus DNA, que necesitan hacer metilaciones dependienABRIL 2001
FARMACOLOGÍA
O
H3C
NH
O
HO
O
NH2
O
N
H3C
N
O
HO
O
N
NH
N
O
HO
O
N3
Zalcitabina (ddC)
Zidovudina (AZT)
NH2
Estavudina (d4T)
O
HN
N
N
NH
N
N
O
O
HO
HO
O
N
N
HO
N
N
N
NH2
S
Lamivudina
Didanosina (ddI)
Abacavir
Fig. 17. 2’,3’-dideoxinucleósidos inhibidores de la TI del VIH.
tes de la S-adenosilmetionina. Por
conjugación estructural entre este
compuesto y los fosfonatos (en
concreto el ácido fosfonoacético,
homólogo superior del foscarnet)
se llega a una nueva clase de antivirales, los fosfonatos de aciclonucleósidos (fig. 15).
El HPMPC (cidofovir) puede
usarse frente a CMV, HVH y virus
papilloma humano (VPH), y tiene
una duración de acción muy larga
por su alta vida media. El cidofovir no sería un estricto terminador
de cadena, pero sí lo es en la práctica puesto que la introducción de
dos consecutivos establece tal tensión de cadena, que impide su
prolongación. Están en fase de estudio clínico análogos, que sí serian
terminadores de cadena estrictos
(fig. 16).
Nucleósidos inhibidores
de la transcriptasa inversa (NRTI)
En 1983 se conoció que el sida era
causado por un retrovirus. El primer éxito en su tratamiento fue el
uso del análogo de nucleósido
AZT (zidovudina, 3’-azido-3’diseoxitimidina), que había sido
96 OFFARM
sintetizado 20 años antes como
potencial antitumoral.
Todos los utilizados en clínica
actualmente son 2’,3’-dideoxinucleósidos (fig. 17) y actúan de una
manera muy similar. Se mono-, diy trifosforilan intracelularmente,
Mientras que el aciclovir
es dependiente de una
enzima codificada por
el virus para su primera
fosforilación, el AZT
es activado en todos
sus pasos por enzimas
de la célula huésped
de esta manera engañan a la polimerasa y al ser incluidos en el
ácido nucleico que se está formando, actúan como terminadores de
la cadena al no poder prolongarse
la misma por carecer del grupo
hidroxilo de la posición 3’.
El AZT entonces, como el aciclovir, es también un terminador
de cadena, pero la mayor diferencia entre ambos modos de acción
es en el ámbito de la activación
por las quinasas. Mientras que el
aciclovir es dependiente de una
enzima codificada por el virus
para su primera fosforilación, el
AZT es activado en todos sus
pasos por enzimas de la célula
huésped. Este proceso de activación convierte al AZT en un fármaco mucho menos selectivo y
con menor margen de seguridad.
El AZT manifiesta solo una especificidad modesta por la transcriptasa inversa, aunque en este punto
es conveniente hacer notar que en
cualquier caso, el efecto es más
drástico sobre el genoma viral que
sobre el genoma de la célula huésped, porque esta última tiene un
sistema de control celular más
desarrollado que lleva a detectar y
reparar con más eficacia el daño,
de cuanto pueden hacerlo los organismos más simples.
Esta mayor falta de especificidad
se traduce en la aparición de efectos indeseables cuando se prolonga
ABRIL 2001
FARMACOLOGÍA
O
NH2
N
N
HO
N
N
N
NH2
HO
N
O
OH
N
N
F
Lobucavir
Lodenosina
NH2
N
O
RO
P
RO
N
N
O
O
N
RO
P
OR
N
O
Adefonir (PMPA)
Fig. 18. Lobucavir, lodenosina y adefovir.
O
H3C
HN
N
N
N
Nevirapina
N
H3C
O
S
N
H
N
N
O
N
H
F3C
O
O
Efavirenz
Fig. 19. Inhibidores no nucleosídicos de la TI del VIH.
98 OFFARM
– Cuando el virus se hacía resistente al AZT, mantenía su sensibilidad frente a ddC y ddI (por lo
tanto, no se producía resistencia
cruzada incluso en fármacos que tienen como diana la misma enzima).
– Cuando se utiliza la combinación se produce un efecto sinérgico
sobre las actividades individuales.
– El VIH en un paciente tratado
con AZT adquiere mutaciones en
el gen de la TI que le incrementa
la resistencia al AZT. Si se cesa el
tratamiento con AZT y se continúa con un nucleósido alternativo,
resulta la posterior adquisición de
una posterior mutación que le confiere resistencia a este segundo
nucleósido, pero suprime las
«lesiones inducidas por AZT» y se
produce reversión de la sensibilidad a AZT (fenómeno de supresión de resistencia).
Por otro lado, se intenta mejorar
la selectividad de estos análogos
estudiando moléculas lo más alejadas posible del modelo para tratar
de no engañar a la ADN polimerasa
celular. Así están en fase clínica de
estudio derivados de ciclobutano,
derivados con sustituciones por átomos de flúor o fosfonatos de isósteros de aciclonucleósidos (fig. 18).
Delavirdina
N
H
CH3
CH3
O
CI
HN
el tratamiento (anemia y neutropenia fundamentalmente), pero el
mayor problema fue, de todas
maneras, la aparición de resistencias. Esto puede reducirse con fármacos alternativos que puedan ser
usados en combinación, y la experiencia en el campo de antimicrobianos sugería que la mejor asociación sería aquella en la que los
componentes atacasen diferentes
dianas farmacológicas.
Sin embargo, como los primeros
fármacos disponibles para el sida
después del AZT fueron otros
2’,3’–dideoxinucleósido análogos y
su diana la TI, combinaciones
entre estos fueron las primeras
ensayadas. De estas combinaciones, tres cosas me parecen especialmente destacables y sorprendentes:
No nucleósidos inhibidores
de la transcriptasa inversa (NNRTI)
Los primeros compuestos inhibidores de la TI de este tipo fueron
los denominados HEPT y TIBO a
ABRIL 2001
FARMACOLOGÍA
principios de los años noventa.
Estos compuestos interfieren con
la primera de las funciones de la
TI [a) transcripción del ARN viral
a ADN para formar híbridos
ARN.ADN; b) degradación de la
cadena de ARN, y c) replicación
del ADN monocatenario] uniéndose de manera «no competitiva» en
un sitio diferente (subunidad p66)
del sitio catalítico, pero espacial y
funcionalmente relacionado con el
sitio de unión del nucleótido trifosfato. De esta manera el nucleótido trifosfato podría unirse a la
enzima, pero el resultado es que no
puede incluirlo en la cadena de
ácido nucleico, posiblemente porque el NNRTI fuerza una estereoquímica «no eficaz» en la enzima.
Se utilizan en clínica 3 compuestos (fig. 19). Todos ellos presentan
estructuras muy diferentes pero
que pueden caracterizarse por una
disposición de dos estructuras
lipófilas en «alas de mariposa» con
un cuerpo central hidrófilo7.
Terapia antisentido
Núcleo
ADN
Citoplasma
mARN
mARN
Antigén
Proteína
Antisentido
Fig. 20. Terapia antigén y terapia antisentido.
resulta de la sustitución de (P = O)
por (P = S) (fig. 21).
Estos son los que pueden considerarse de primera generación y a
este grupo pertenece el único fármaco actualmente en uso clínico
como antiviral, el fomivirsen (fig. 22),
que funciona como hebra complementaria del mARN de CMV en
la región 2, que codifica proteínas
de regulación.
El átomo de azufre es solo ligeramente más grande que el átomo de
oxígeno y al ser menos electronegativo, deja una menor carga positiva sobre el átomo de fósforo,
siendo así más dificilmente degradable por las nucleasas. Los PS-oligos mostraron un efecto antisentido global superior a ninguna otra
de las modificaciones realizadas.
A pesar de estas ventajas de los
PS-oligos sobre los PO-oligos, ni
la estabilidad frente a nucleasas, ni la
biodisponibilidad fueron óptimas
y, sin embargo, son propensos a
unirse de forma no selectiva a diferentes proteínas, lo que les confiere los efectos colaterales. Para
superar los problemas y no perder
la potencia ya alcanzada con los
PS-oligos, se está trabajando en los
Se conoce como terapias antigén y
antisentido a aquellas estrategias
terapéuticas que nos permiten realizar un bloqueo de la función del
ADN en el núcleo o del ARNm
en el citoplasma de las células
respectivamente, por acoplamiento
de una nueva hebra de oligonucleótido o análogo (fig. 20). La terapia
antisentido es más factible porque
O
el oligo no tiene que penetrar en el
B
O
3a
núcleo celular .
El acoplamiento de la nueva hebra
Furanosa
o cadena se basa en los mismos
Posibles sitios de modificación
principios por los cuales la naturaleO
O
za regula la información genética: la
–
Fosfodiéster
complementariedad de los pares de
O
O
bases A-T o A-U y G-C.
B
O
Los oligonucleótidos no modificados tienen importantes problemas para ser usados en terapéutica:
poca permeabilidad celular, fácil
O
O
O
O
degradación por nucleasas e incluso
O
S
–
baja afinidad por secuencias de
O
O
O
O
O
O
RNA. Esto lleva a pensar en la
posibilidad de modificación de oligonucleótidos naturales bien sea en
PO-óligo
PS-óligo
las porciones correspondientes a los
anillos de furanosa o bien sea en los
enlaces fosfodiéster5c. La modificación con fosforotioato (PS-oligos) Fig. 21. Oligonucleótidos (PO-oligos) y oligonucleótidos modificados (PS-oligos).
100 OFFARM
ABRIL 2001
FARMACOLOGÍA
d(p-tio)(GCGTTTTGCTCTTCTTCTTGCG)deoxirribonucleico
Fig. 22. Fomivirsen (ISIS-2922).
llamados «oligo mixtos» (MBO,
mixed backbone oligos)8, que contienen más de un tipo de modificación de esqueleto, aunque una
parte se mantiene de PS-oligo.
Podemos considerarlos oligos de
segunda generación y la elección
de estas modificaciones y su posición en el MBO es clave para tratar de conseguir las propiedades
antisentido deseadas. Se consiguen
de esta manera oligos más seguros
y también oligos en los que la
absorción está facilitada porque se
reduce la carga global de estas
moléculas, con porciones de análogos casi neutros como los poliamida-ácidos nucleicos (PNA), o con
guanidinas o tioureas sustituyendo
al grupo fosfodiéster, lo que le
confiere cargas positivas a pH ~7
por lo que junto a las negativas
otorgadas por los PS-oligos, son
moléculas con carácter zwiteriónico y casi carga global neutra.
Interferones
Los interferones (adoptan su nombre de «interferencia») son citocinas (cyto-célula y kinesis-movimiento): proteínas solubles en agua o
glicoproteínas que libera una
población celular como mediador
intercelular o molécula de señalización, es decir, moléculas que son
capaces de producir y liberar
determinadas células para interrelacionarse con otras.
Los interferones son citocinas de
bajo peso molecular (aproximadamente 20.000, alrededor de 145
aa.) producidas por muchas células
eucariotas como respuesta a muchos
agentes inductores.
Se descubren en 19579 y los más
conocidos e importantes son: IFNα, que se producen por infeccion
viral de leucocitos; IFN-β, que se
producen por infección viral de
fibroblastos; IFN-γ, que se produ-
N
N
O
O
O
Tilorone
OH
—(C )
18
N
N
—(C )
18
N
N
Propanodiamina sustituida
Fig. 23. Inductores de interferón.
ABRIL 2001
OH
N
Imiquimod
ce por intervención de un antígeno
sobre células T (también se llama
interferón «inmunitario»); y los
interferones ω y τ, que son producidos por la placenta.
Pueden tener entonces diferentes
actividades farmacológicas entre las
que destacan como más importantes
la antiviral y la antitumoral. Los más
interesantes como antivirales son los
IFN-α (que son en realidad 20 familias, siendo los utilizados en el tratamiento de la hepatitis C el IFN-α2a
y el IFN-α2b) y los IFN-α. Estos son
además los más parecidos entre sí,
aunque el β es una glicoproteína y,
sin embargo, el α es una proteína.
Los interferones
son citocinas de bajo
peso molecular
(aproximadamente
20.000, alrededor de
145 aa.) producidas por
muchas células
eucariotas como
respuesta a muchos
agentes inductores
Los interferones se producen en
una célula cuando es infectada por
un virus y se liberan protegiendo a
otras células de la infección (las
células sanas casi no tienen interferón puesto que este ha de ser inducido), o mejor, impiden que el
virus pueda realizar su ciclo reproductivo en ellas (el interferón
interfiere con la multiplicidad
viral). Aunque este mecanismo de
acción está suficientemente contrastado, no está descartado que
pudiese tener adicionalmente
algún tipo de influencia en la liberación del virus de las células
infectadas o incluso en los procesos
de entrada, por interacción del
interferón con receptores de membrana de las células.
Las características fundamentales
que los hacen interesantes como
fármacos son las siguientes:
OFFARM
101
FARMACOLOGÍA
– Son muy potentes y de amplio
espectro (a diferencia de un anticuerpo que produce una inmunidad
muy específica), es decir, no son
específicos para el virus, pero sí lo
son para la especie que los produce.
– Son muy seguros, exentos prácticamente de toxicidad por su alta
selectividad en la acción antiviral.
Los mayores problemas que presentan para ser utilizados como
fármacos son:
– Como todas las proteínas, son
inestables (aunque el IFN-α y -α
resisten bien el pH ácido y temperaturas de hasta 40-50 ºC) y tienen
baja biodisponibilidad por problemas de absorción, de unión a otras
proteínas plasmáticas y de fácil
biodegradación
– No tienen actividad frente a
células infectadas, o tienen muchísima menos, por lo que, en este
sentido serían más interesantes
como preventivos que como curativos.
– Es difícil y caro obtenerlos
puros, aunque ahora es más sencillo al utilizar técnicas de ADN
recombinante.
Precisamente, para tratar de
minimizar estos problemas se realiza un amplio esfuerzo en el desarrollo de fármacos que pudiesen
actuar como «inductores de interferón», trabajando en dos frentes:
– Pequeñas moléculas. Fue experimentado el tilorone que es un
buen inductor en ratón, pero no
así en humanos. Están en fase de
experimentación clínica diversas
propanodiaminas substituidas. Fue
ya introducido en clínica recientemente el imiquimod, para el tratamiento de verrugas genitales externas producidas por VPH (fig. 23).
Este fármaco forma parte entonces,
de un nuevo grupo que puede llamarse «modificadores de la respuesta inmunitaria», desprovisto
de efectos antivirales directos.
– Polímeros. Se trata de polirribonucleótidos de doble hélice. Hasta
el momento merece especial mención el poli I:C, que es un polirribonucleótido formado por una
cadena con la base de inosina y la
complementaria, con base de cito-
sina. Para hacerlo más resistente a
la hidrólisis, se estabiliza complejándolo con poli L-lisina y carboximetilcelulosa (poli ICLC). ■
Bibliografía y notas
1. Considero de utilidad para aspectos
generales de virus: a) Ingraham JL,
Ingraham CA. Introducción a la microbiología. Barcelona: Reverté, 1998, y
b) Prescott LM, Harley JP, Klein DA.
Microbiología. México: McGraw-Hill
Interamericana, 1999.
2. On drugs and therapeutics. The Medical
Letter 2000; 5-11. Para infecciones virales
no causadas por HIV (páginas 17-22 para
infección por HIV). Fármacos concretos se
encuentran en Drugs of the future.
3. Considero de utilidad para aspectos
generales de terapia antiviral: a) Bastow
KF, Akanitapichat P. Antiviral agents.
En: J. Wiley. Burger’s Medicinal Chemistry and Drug Discovery. Vol. 4. 5.a
ed., 1997, y b) Blair E, Darby G, Gough
G, Littler E, Rowlands D, Tisdale M.
Antiviral therapy. Berlín: Bios Scientific
Publishers. Springer-Verlag, 1998.
4. En 1952, Renato Dulbecco (Premio Nobel
1975) utilizó por primera vez un cultivo
celular para el crecimiento de virus.
5. De Clercq E. Antiviral therapy for
human immunodeficiency virus infections. Clin Microbiol Rev 1995; 8 (2):
200-239 (a: página 204 y referencias
citadas; b: páginas 218-220, y c: páginas 217-218).
6. Kim ChU, Lew W, Williams MA, Liu
H, Zhang L, Swaminathan S, Bischofberger N, Chen MS, Mendel DB, Tai
ChY, Laver WG, Stevens RC. Influenza neuraminidase inhibitors possessing
a novel hidrophobic interaction in the
enzyme active site: design, synthesis,
and structural analysis of carbocyclic
sialic acid analogues with potent antiinfluenza activity. J Am Chem Soc
1997; 119: 681-690. Una recopilación
interesante de este artículo con bibliografía adicional, la realiza Schnaar RL.
Chemtracts-Biochemistry and Molecular Biology 1998; 11: 222-228.
7. De Clercq E. Non-nucleoside reverse
transcriptase inhibitors (NNRTIs) for
the treatment of human immunodeficiency virus type 1 (HIV-1) infections:
strategies to overcome drug resistance
development. Med Research Rev 1996;
16 (2): 125-157.
8. Zhou W. Mixed-backbone oligonucleotides as second generation antisense
drugs. Drugs of the Future 2000; 25
(2): 183-191.
9. Isaacs A, Lindenmann J. Prod R Soc
1957; B147: 258-263.
Descargar
Fichas aleatorios
Crear fichas