Subido por Fanny Alanís

PPA-2-TBTM-2018

Anuncio
UNIVERSIDAD AUTÓNOMA DE NUEVO LEÓN
FACULTAD DE CIENCIAS BIOLÓGICAS
CURSO DE TÓPICOS DE BIOTECNOLOGÍA
MOLECULAR
PRODUCTO INTEGRADOR II: CARACTERIZACIÓN GENOTÍPICA DE UN OGMS
Elaborado por:
Fecha
22/abril/2018
Karlamaría Rojas Mercado
Cristina Elizabeth Manjarrez Alfaro
Orlando Segura Vazquez
Ilse Mariana Quilantan Sánchez
Carlos Delgado Rojas
Páginas
15
Gpo:283
Una empresa ha desarrollado una cepa de levadura metilotrófica por ingeniería genética. La cepa es
portadora de la secuencia que codifica para la α-glucosidasa de Litopenaeus vannamei, y se emplea para
la producción de esta enzima. La α-glucosidasa produce la hidrólisis de oligosacáridos y polisacáridos
liberando α-D-glucosa y se emplea en la industria de alimentos o en el área de diagnóstico. La empresa
requiere de un control de calidad de la cepa antes de someterla al bioproceso de producción, para lo cual
antes inocular el fermentador requiere de caracterizar la cepa, para confirmar la presencia del gen
heterólogo. Para resolver este problema, lo ha contratado a Usted como un QBP experto en biotecnología
molecular para lo cual se le solicita un reporte técnico para el control de calidad de la cepa y Usted cuenta
con la siguiente información:
1. La secuencia que codifica para la enzima alfa glucosidasa de camarón (Litopenaeus
vannamei antes Penaeus vannamei) está reportada en el GenBank (banco de secuencias
nucleotídicas) (Penaeus vannamei alpha glucosidase, Le Chevalier, P.A., Sellos, D.Y. and
Van Wormhoudt, A.E).
2. Se cuenta con un par de oligonucleótidos diseñados por Ud y que suponen hibridan en la
secuencia que codifica para la α-glucosidasa.
Oligonucleótido Glu1: GAGCGTCGACAAAAGACAACAGACGAAGCTGCAGGCG
Oligonucleótido Glu2: AAACCCTAGGTTACAGGCCATCATTGTC
Con esta información Ud propone realizar las siguientes actividades para integrar el reporte técnico:
1) Confirmar si los oligonucléotidos diseñados son adecuados, para lo cual decide evaluar la
especificidad de los oligonucleótidos y comprobar si se logra obtener una amplificación específica
mediante herramientas bioinformáticas. Al realizar la amplificación in silico con los iniciadores
diseñados, se determina el tamaño del fragmento amplificado.
Alineamiento del oligonucleótido Forward (Glu1) por medio del programa BLAST obteniendo la
secuencia CAACAGACGAAGCTGCAGGCG para realizar la amplificación in silico.
©Tópicos en Biotecnología Molecular FCB, UANL,2017
Abril, 2018
Página 2 de 15
Alineamiento del oligonucleótido Reverse (Glu2) por medio del programa BLAST obteniendo la
secuencia TTACAGGCCATCATTGTC para realizar la amplificación in silico.
©
Por medio de primer BLAST se colocan los oligonucleótidos
Glu1: CAACAGACGAAGCTGCAGGCG y Glu2: TTACAGGCCATCATTGTC para la
amplificación teórica y la especificidad de estos.
Tópicos en Biotecnología Molecular FCB, UANL,2017
Abril, 2018
Página 3 de 15
Se muestra que Glu1: CAACAGACGAAGCTGCAGGCG y Glu2: TTACAGGCCATCATTGTC
amplifican para la enzima α-glucosidasa. Amplificaron un fragmento de 2700 pb sin embargo se suman
los fragmentos de los primers no amplificados:
2700 + 16 (Forward) + 10 (Reverse) = 2726 pb
©Tópicos en Biotecnología Molecular FCB, UANL,2017
Abril, 2018
Página 4 de 15
2) Realizar una caracterización genotípica de la cepa recombinante. Para lo cual propone realizar:
a) Una preparación de DNA genómico de la cepa. Lo cual requiere de un cultivo y la obtención
de un paquete celular a partir del cual se extraerá el DNA. El DNA obtenido se analizará
para determinar su concentración y su calidad.
b) Determinar la presencia del gen heterólogo en el genoma de la cepa mediante PCR, para lo
cual desarrolla un protocolo de PCR con los oligonucleótidos diseñados.
c) Caracterizar el fragmento amplificado mediante enzimas de restricción, para lo cual
propone una enzima de uso frecuente, que corte una solo vez el fragmento y que produzca
fragmentos que resuelvan en un gel de agarosa, lo cual verificará con el uso de herramientas
bioinformáticas antes de comprar los insumos para realizar el análisis.
Caracterización por medio de enzimas de restricción in silico con EcoRI donde se obtiene un
producto visible con gel de agarosa 0.7% obteniendo dos bandas de tamaño de 2072 pb y 654 pb.
©Tópicos en Biotecnología Molecular FCB, UANL,2017
Abril, 2018
Página 5 de 15
UNIVERSIDAD AUTÓNOMA DE NUEVO LEÓN
FACULTAD DE CIENCIAS BIOLÓGICAS
CURSO DE TÓPICOS DE BIOTECNOLOGÍA
MOLECULAR
5) Realizar un reporte técnico a la empresa. El reporte debe de realizarse de acuerdo al formato
que aprendió en su formación en el curso de Tópicos de Biotecnología Molecular de su carrera y
debe de incluir los puntos comprometidos a realizarse y arriba mencionados. En el reporte técnico
deberá de que considerar lo siguiente para las secciones de metodología y resultados:
OBJETIVO
Obtener DNA genómico a partir de la cepa de Pichia pastoris por el método de solventes orgánicos para
comprobar bioinfomáticamente y experimentalmente si contiene la secuencia codificante de la α glucosidasa de Litopenaeus vannamei, con la ayuda de la técnica de PCR se ampliará el DNA que se
obtuvo para observar las cepas recombinantes.
FUNDAMENTO
Para poder llevar a cabo la preparación y el análisis de DNA genómico de una levadura se pueden utilizar
técnicas como el método de extracción de solventes orgánicos (TSNT) que permitirá una lisis celular y
posterior purificación del DNA. (Tamay, et al 2013)
La cuantificación del DNA se puede llevar a cabo mediante espectrofotometría y electroforesis en gel de
agarosa con marcadores de concentración conocida.
Esta es de las más utilizadas para analizar y caracterizar ácidos nucleicos de distintas procedencias. Los
geles se comportan como un tamiz molecular y permiten separar moléculas cargadas en función de su
tamaño y forma. Así, moléculas de DNA de diferente tamaño van a emigrar de forma distinta en una
electroforesis en gel de agarosa. Además, si en dicha electroforesis se aplican marcadores de peso
molecular (fragmentos de DNA de tamaño conocido) se puede calcular el tamaño aproximado del DNA
en estudio.
En el caso de los geles de agarosa, se le añade bromuro de etidio, sustancia que se intercala entre las bases
del DNA y es fluorescente cuando se ilumina con luz ultravioleta. Tras la electroforesis, se visualiza el
gel con una lámpara de luz UV, y se verán las bandas correspondientes a las muestras de DNA aplicado
y los marcadores de peso molecular.
Dado que el DNA posee carga negativa por sus grupos fosfato es atraído electrostáticamente por el cátodo
de la cámara de electroforesis a partir del extremo del anodo. Las bandas de DNA de mayor tamaño se
verán en la parte superior del gel.
©Tópicos en Biotecnología Molecular FCB, UANL,2017
Abril, 2018
Página 6 de 15
La reacción en cadena de la polimerasa (PCR) es una reacción enzimática in vitro que amplifica millones
de veces una secuencia específica de ADN durante varios ciclos repetidos en los que la secuencia blanco
es copiada fielmente. Para ello, la reacción aprovecha la actividad de la enzima ADN polimerasa que tiene
la capacidad de sintetizar naturalmente el ADN en las células. En la reacción, si usamos como sustrato
ADN genómico, entonces típicamente hablamos de una PCR, pero si usamos ADN complementario
(ADNc) proveniente del ARNm (ácido ribonucleico mensajero) se le conoce como RT-PCR. Esta
conversión se logra mediante una reacción conocida como transcripción reversa y controlada por la
enzima transcriptasa reversa, capaz de convertir el ARNm en una molécula de ADNc. Este método fue
copiado de los retro virus que usan una transcriptasa reversa para convertir su genoma de ARN en ADN
duplicarse en millones de partículas virales. El ADNc se utiliza cuando analizamos la expresión del
ARNm de algún gen de interés. Los elementos importantes en la reacción son el templado o molde (ADN
o ADNc), la enzima, los oligonucleótidos o primers, los desoxirribonucleótidos trifosfatados (dNTPs:
adenina, timina, citosina y guanina), el ión magnesio (Mg +), una solución amortiguadora o buffer y H2O.
Todos estos elementos interactúan en tres etapas principales de las que se compone la PCR:
desnaturalización, hibridación y extensión. Los equipos en donde se realiza la reacción son llamados
termocicladores, los cuales están diseñados para establecer un sistema homogéneo en donde las
condiciones de temperatura y tiempo necesarios no se modifiquen en cada uno de los ciclos. Al final de
la reacción, para corroborar si se amplificó la secuencia blanco de interés, los productos de la PCR son
analizados en geles de agarosa para confirmar si la reacción fue exitosa. (Tamay et al, 2013)
©Tópicos en Biotecnología Molecular FCB, UANL,2017
Abril, 2018
Página 7 de 15
MATERIALES Y EQUIPOS
Equipos
Agitador Vortex
Autoclave
Campana bacteriológica
Congelador de -20ºC
pH metro
Transiluminador
Equipo para
electroforesis
-Cámaras horizontales
-Fuentes de poder
-Accesorios
Espectrofotómetro
Cámara de electroforésis
Espectrofotómetro.
Incubadora a 37ºC, con agitación
Juego de micropipetas
Máquina de hielo
Centrifuga
Refrigerador
Baños de agua
Microcentrífuga
Balanza analítica
Fuente de poder
Termociclador
MATERIALES
Guantes desechables sin talco
Bolsa de plastico
Gradillas de plástico
Hielera
Mechero
Cajas de plástico para guardar tubos
con muestras
Toallas absorbentes
Contenedor para deshechos de material biológico
Contenedor para deshechos de fenol
Puntillas estériles para micropipetas (azules,
amarilla y blancas)
Tubos Eppendorf de (1.5mL 0 2mL)
Contenedor para desechos químicos
Celdas de plástico
Material biológico, soluciones, medios de cultivo y reactivos
Cepa de Pichia pastoris pPic α-Glu,
KM71.
Medio de cultivo YPD (Extracto de
levadura 1%, Peptona 2%,
Glucosa 2%)
SEVAG
(cloroformo: alcohol
isoamílico, 24:1)
Etanol al 100%
H2Oestéril
Oligonucleótidos 5 μM c/u.
TSNT(Tritón X-100 al 2%, SDS al 1%, NaCl
100Mm, Tris-HCl 10Mm y EDTA 1mM
pH=8)
TE 1X (Tris-HCl 10mM pH= 8, y EDTA 1mM
pH=8)
Fenol
Etanol al 70%
Buffer de lisis
Buffer Green
dNTP’s 10 μM
©Tópicos en Biotecnología Molecular FCB, UANL,2017
Abril, 2018
Página 8 de 15
GoTaq DNA Polimerasa 5 U/mL
Gel de agarosa al 0.8%
DNA 200 ng/mL
Marcador molecular Hyper Ladder 1 (BIOLINE)
PROCEDIMIENTO
Herramientas bioinformáticas utilizadas en el punto 1
En el Gen Bank del NCBI se localizó La secuencia que codifica para la enzima alfa glucosidasa de
camarón (Litopenaeus vannamei antes Penaeus vannamei) y se verifico que concuerden los autores.
La amplificación y caracterización in silico se realizó por medio del programa BLAST
Crecimiento celular
1.100 µL cepa KM71 de Pichia pastoris
2. agregar 10 mL de YPD
3. Incubar a 30ºC, 250 rpm por 24 horas. Hasta alcanzar la fase exponencial (DO600 nm de 6˜10).
4. 4 mL del cultivo por centrifugaciones sucesivas
5. Centrifugar por 5-10 minutos a 16,000 g para separar el paquete celular, decantar el sobrenadante.
6. Guardar el paquete celular a -20 C para su posterior uso
Proceso general
Homogenización (Lisis celular)
1. Añadir al paquete celular 200 µL de la solución amortiguadora de lisis TSNT, mezclar perfectamente
por inversion o con pipeta.
Extracción de contaminantes
1. Agregar 500 µL de fenol saturado y mezclar por inversión.
2. Agregar 100 µL de cloroformo-alcohol isoamílico 24:1.
3. Agitar en el vortex 5 min
4. Añadir 200 µL de TE 1X pH8 y mezclar por inversión de tres a cinco veces.
5. Centrifugar 8 min a 14,000 rpm y transferir la fase acuosa a un tubo Eppendorf de 2.0 mL.
Precipitación y lavado de DNA
1. Precipitar el DNA agregando 1 mL de etanol 100%. Mezclar lentamente por inversión hasta observar
la precipitación del DNA en forma de una hebra blanca.
2. Centrifugar 8 min a 14,000 rpm.
3. Decantar el sobrenadante teniendo cuidado de que no se desprenda la pastilla de DNA.
4. Lavar con 1000 µL de etanol al 70% y mezclar por inversión.
5. Centrifugar 8 min a 14,000 rpm, decantar y secar a temperatura ambiente de 5–10 min.
6. Secar
©Tópicos en Biotecnología Molecular FCB, UANL,2017
Abril, 2018
Página 9 de 15
Solubilización
1. Resuspender en 50 µL de TE 1X pH=8 y almacenar a 4º C para posteriormente determinar
concentración y calidad de la muestra de DNA.
2. Calentar a 65 C por 20 min.
Protocolo PCR
Preparación de tubos
1. Limpiar y despejar el área pre-PCR.
2. Etiquetar tres tubos Eppendorf con equipo, grupo y control positivo, negativo o muestra según sea el
caso.
3. Resuspender el DNA plasmídico de P. pastoris KM71-pPic α-Glu 20ng/µl en 10µl de Buffer TE.
4. Tomar 36.9µl de H2O estéril (MiliQ) con la micropipeta y depositarlos en uno de los tubos
Eppendorf etiquetado.
5. Agregar al tubo 15µl de Buffer Green 5X.
6. Añadir 7.5µl del oligonucleótido 1 5µM al tubo.
7. Repetir el paso 6 con el oligonucleótido 2.
8. Tomar 1.5µl de dNTP’s 10mM y añadirlos al tubo Eppendorf.
9. Agregar 0.6µl de Go Taq DNA Polimerasa 5U/µl al tubo de reacción.
10. Tomar 23µl de esta reacción y añadirlos a un nuevo tubo Eppendorf etiquetado.
11. Repetir la acción 10 con el tubo restante etiquetado, para que tres tubos contengan 23µl cada uno.
12. Agregar 2µl de agua estéril (MiliQ) al tubo etiquetado como control negativo, para obtener un
volumen final de reacción de 25µl.
13. Añadir 2µl de DNA plasmídico para control positivo de P. pastoris KM71-pPic α-Glu al tubo para
la reacción de control positivo, teniendo como volumen final 25µl.
14. Agregar 2µl de DNA plasmídico de P. pastoris KM71-pPic α-Glu20ng/µl al tubo etiquetado como
muestra, teniendo un volumen final de 25µl.
Ensayo en termociclador
15. Ingresar los tres tubos al termociclador y ajustarle los parámetros necesarios:
Etapa
Paso
Condición
1
Paso 1
92ºC por 2 minutos
Paso 1
92ºC por 1 minuto
50ºC por 30
2
Paso 2
segundos
Paso 3
72ºC por 2 minutos
72ºC por 10
3
Paso 1
minutos
4ºC por tiempo
4
Paso 1
indefinido
Número de ciclos
1 ciclo
30 ciclos
1 ciclo
Infinito
16. Sacar los tubos del termociclador.
©Tópicos en Biotecnología Molecular FCB, UANL,2017
Abril, 2018
Página 10 de 15
Ensayo de electroforesis
17.
Preparar una mezcla de agarosa a 0.8% en buffer TBE 1X
18.
Calentar y agitar la mezcla hasta que se encuentre disuelta.
19.
Agregar en la cámara elecrtoforética aproximadamente 50ml de la mezcla.
20.
Colocar el peine de plástico sobre la mezcla.
21.
Esperar 30 minutos o hasta que solidifique la solución.
22.
Retirar los peines, y colocar cubriendo la superficie del gel, buffer TBE 1X
23.
Mezclar 2µL del marcador de peso molecular 1 Kb Ladder con 2.5µL de GelRed y 2.5µL d
Green Buffer.
24. Adicionar en el primer carril los 7 µL totales anteriores.
25. Tomar 2µL de muestra de DNA y adicionar 2.5µL de GelRed.
26. Añadir la mezcla anterior en el pocillo correspondiente.
27. Repetir el paso 25 y 26 para el control negativo y positivo.
28. Correr el gel a 100V a 85mA durante treinta y cinco minutos.
29. Retirar el gel de la cámara electroforética.
30. Colocar el gel en el transluminador.
31. Observar y analizar los resultados.
COMENTARIOS Y RECOMENDACIONES:
Todas las puntillas y tubos deben ser previamente esterilizados. Se debe tener sumo cuidado con las
posibles fuentes de contaminación que podrían acarrear los tubos al momento de preparar estos con
las muestras y controles. Debido a ello, el uso de guantes es estrictamente necesario. También es muy
recomendable la limpieza del área de trabajo antes de comenzar con la experimentación. La enzima
de restricción deber ser el último elemento añadido a la mezcla y no antes de algún otro reactivo. Se
debe tener cuidado de pasar el volumen de TE por las paredes del tubo.
©Tópicos en Biotecnología Molecular FCB, UANL,2017
Abril, 2018
Página 11 de 15
Figura 2. En todos los casos se corrieron en el gel 5µL de la muestra de DNAg. El marcador de peso
molecular empleado fue: Hyper Ladder 1 (BIOLINE). Las condiciones de corrimiento fueron: Gel de
agarosa al 0.8 %, Buffer de corrimiento TBE 1X 80 minutos 100 volts 85 mili amperes.
No se muestra ninguna banda en ninguno de los carriles, solo el control positivo, esto puede indicar
que se llevó a cabo un mal procedimiento o quizás los manipuladores brincaron un paso, lo que
conllevo a este error, sin embargo, se esperaba observar para el equipo 1,4 y 5, la detección de la cepa
recombinante de Pichia pastoris.
©Tópicos en Biotecnología Molecular FCB, UANL,2017
Abril, 2018
Página 12 de 15
DISCUSION
Al analizar la fotografía de la electroforesis los carriles del 1 al 6, se observa una banda de más de 10 000pb,
misma que corresponde al tamaño del ADN genómico aislado, pues como señala Schutter K., el genoma de la
cepa que se empleó tiene una cantidad de más de 9.3Mpb. El resto de los carriles exhiben un patrón similar al de
la muestra de interés con ligeras variaciones con respecto a la intensidad de las bandas, indicando que el ADN
está presente.
Por consiguiente, se realizó un PCR y como resultado no se mostró ninguna banda en ninguno de los carriles,
solo el control positivo, esto puede indicar que se llevó a cabo un mal procedimiento o quizás los manipuladores
brincaron un paso, lo que conllevo a este error, sin embargo, se esperaba observar para el equipo 1,4 y 5, la
detección de la cepa recombinante de Pichia pastoris.
Se debe considerar que para determinaciones precisas por análisis la muestra no debe estar contaminada, debido
a que los contaminantes invalidan los resultados de concentración obtenidos (Rada y Taboada, 1998).
Gómez (2011) menciona que, al realizar una extracción de DNA, la electroforesis nos permite ver si hay errores
o no en el protocolo de la extracción, en donde menciona que cuando se observan bandas extendidas, esto puede
indicar una degradación del material genético, mientras que, si hay cambios en la fluorescencia de las bandas,
nos indica que puede haber la presencia de contaminantes.
El PCR es aplicado para Pichia pastoris para cuantificar los casetes de expresión integrados (Stryer, 2003).
Como eucariota, Pichia pastoris tiene muchas de las ventajas de eucariotas superiores sistemas de expresión
tales como procesamiento de proteínas, plegamiento de proteínas y modificación postraduccional, mientras que
es tan fácil de manipular como E. coli o Saccharomyces cerevisiae (Watson,2006). Es más rápido, más fácil y
menos costoso de usar que otros sistemas de expresión eucariotas tales como baculovirus o cultivo de tejidos de
mamíferos, y generalmente da niveles de expresión más altos. La levadura comparte las ventajas de
manipulaciones moleculares y genéticas con Saccharomyces, y tiene el agregado ventaja de niveles de expresión
de proteínas heterólogas de 10 a 100 veces mayores. Estas características hacen que Pichia sea muy útil como
un sistema de expresión de proteínas (Williams et al 1990).
CONCLUSIONES
La utilización de metodologías de resiembra y conservación que garanticen la calidad de las cepas
preferentemente de calidad ATCC son indispensables para la realización de una hibridación de un
oligómero con las características deseadas por la pureza que las cepas en uso brindan además de ser
cultivos económicos, con altos niveles de producción de las proteínas recombinantes, deficientes en
proteasas y demás características sobre su fisiología y genética factor que presuntamente se vio
afectado pues en la obtención de las bandas para su caracterización la obtención de los resultados no
es favorable pues la prueba no detecto la cepa Pichia pastoris.
LITERATURA CONSULTADA
 Cornejo R., Díaz A., Aguilar B., Munive M. 2014. Herramientas Moleculares Aplicadas en Ecología. Aspectos
teóricos y prácticos. Primera edición. México: SEMARNAT
 Gómez U. (2011). Biotecnología especializada y determinación molecular// extracción y determinación de material
genético/ edición 2 edito. Velledit, Departamento de enfermedades y diagnóstico, Medellín Colombia determinación
prolongada.
 Perera, J., & Tormo, A. 2002. Ingeniería genética: Preparación, análisis, manipulación y clonaje de DNA:
Vol.1. Madrid: Síntesis.
©Tópicos en Biotecnología Molecular FCB, UANL,2017
Abril, 2018
Página 13 de 15
 Rada T., A., Taboada. G. 1998. Métodos de obtención y purificación de ADN humano para su aplicación en
Genética Molecular. BIOFARBO Vol. VI: 63-68.
 Schutter, K., Lin, Y., Tiels, P., Hecke, A., Glinka, S., Weber-Lehmann, J., Callewaert, N. 2009. Genome
sequence of the recombinant protein production host Pichia pastoris. Nat Biotechnol Nature Biotechnology,
561-566.
 Stryer L. (2003): “Bioquímica”, 5ª ed. Editorial Reverté Barcelona, España
 Tamay de D., Ibarra C., Velasquillo C. 2013 Fundamentos de la reacción en cadena de la polimerasa PCR) y de la
PCR en tiempo real, Investigación en Discapacidad, vol 2, num 2
 Williams J, Kubelik K, Livak J & Rafalski Y. (1990). DNA polymorphisms amplified by arbitrary primers are useful
as genetic markers. Rev. Nucleic Acids Res. 18:6531 – 6535 pp.
©Tópicos en Biotecnología Molecular FCB, UANL,2017
Abril, 2018
Página 14 de 15
©Tópicos en Biotecnología Molecular FCB, UANL,2017
Abril, 2018
Página 15 de 15
©Tópicos en Biotecnología Molecular FCB, UANL,2017
Abril, 2018
Página 16 de 15
Descargar
Fichas aleatorios
tarjeta del programa pfizer norvasc

0 Tarjetas joseyepezsumino

tarjeta del programa pfizer norvasc

0 Tarjetas joseyepezsumino

notas de enfermeria

0 Tarjetas Karen LCHB

Sunotel S.L

15 Tarjetas JOHAN Eriksson

Portugueses del siglo XVII

15 Tarjetas Mr. Card

Crear fichas