Animal Reproduction Science 193 (2018) 158–164 Contents lists available at ScienceDirect Animal Reproduction Science journal homepage: www.elsevier.com/locate/anireprosci Germ cell-specific apoptosis by extracellular clusterin in cryptorchid dog testes T Hyunjhung Jhuna,1, Hyun-Jung Parkb,1, Ran Leeb, Hyuk Songb, Tai-Young Hurc, ⁎ Seunghoon Leec, Jin-Ki Parkd, Won-Young Leee, a Research Group of Nutraceuticals for Metabolic Syndrome, Korea Food Research Institute, Jeonbuk 55365, Republic of Korea Department of Stem Cell and Regenerative Biology, Konkuk University, Seoul 05029, Republic of Korea c Animal Biotechnology Division, National Institute of Animal Science, RDA, Jeonbuk 55365, Republic of Korea d Department of Swine & Poultry Science, Korea National College of Agriculture and Fisheries, Jeonbuk 54874, Republic of Korea e Department of Beef & Dairy Science, Korea National College of Agricultures and Fisheries, Jeonbuk 54874, Republic of Korea b A R T IC LE I N F O ABS TRA CT Keywords: Dog Germ cell Apoptosis Clusterin Cryptorchidism Mammalian testes are maintained at a relatively lesser temperature than the abdominal region so that normal spermatogenesis can occur. Germ cell apoptosis has resulted in heat-damaged testes that occurs as a result of cryptorchidism, but the mechanism is not yet fully understood. To elucidate the cause of germ-cell death by cryptorchidism, cryptorchidism was surgically induced in dog testes and histological and molecular analyses were performed. Histological data indicated that the seminiferous tubules of cryptorchid testes and epididymis contained fewer germ cells. Total RNA sequencing was performed to screen for overexpressed genes in cryptorchid dog testes. Clusterin RNA was in greater abundance (approximately 12.8-fold) in cryptorchid testes than in normal testes. In addition, cleaved caspase-3 and -8 were detected in greater abundance in cryptorchid dog testes. Real time RT-PCR and western blotting analysis indicated there was a greater abundance of clusterin in cryptorchid dog testes. Furthermore, clusterin was detected in extracellular regions of cryptorchid dog testes during the 4 weeks after surgery. Thus, germ-cell specific apoptosis and expression of clusterin genes occur with a resulting presence of this protein in extracellular regions of cryptorchid dog testes. This result will facilitate further study of spermatogenesis and the specific mechanisms by which cryptorchidism results in male infertility. 1. Introduction Cryptorchidism, defined as the absence of one or both testes from the scrotum, is the most common disorder of sexual differentiation and the most common disease of a male endocrine organ (Serrano et al., 2013). Cryptorchid testes are normally at a greater temperature than normally-descended contralateral testes (Mieusset et al., 1993). Germ-cell loss occurs in animals with experimentally-induced cryptorchidism because scrotal temperature, required for normal spermatogenesis, is a few degrees less than normal abdominal temperature (Lee et al., 2016b). Heat stress in testes can disrupt the seminiferous epithelium, causing lipids to accumulate in Sertoli cells and increasing the apoptotic rates (Cai et al., 2011). Given the resulting germ-cell loss, testicular heat stress is a major factor in male infertility. Although the histological and cellular responses to heat stress in the testes have been well documented, the mechanisms of temperature-induced, germ-cell damage remain largely unknown. ⁎ Corresponding author. E-mail address: [email protected] (W.-Y. Lee). 1 These authors contributed equally to this research. https://doi.org/10.1016/j.anireprosci.2018.04.064 Received 15 January 2018; Received in revised form 7 April 2018; Accepted 11 April 2018 Available online 13 April 2018 0378-4320/ © 2018 Elsevier B.V. All rights reserved. Animal Reproduction Science 193 (2018) 158–164 H. Jhun et al. Clusterin was initially identified in ram rete testis fluid and named for its ability to enhance the clustering of Sertoli cells (Blaschuk et al., 1983). Clusterin has important roles in various tissues, including tissue remodeling, reproduction, transport, and apoptosis (Rosenberg and Silkensen, 1995). Early studies of clusterin elucidated that expression of this gene increased in apoptotic tissue; therefore, it was hypothesized that this protein serves as a marker of cell death (Wong et al., 1994). More recent data, however, have not been consistent with these earlier findings: clusterin exhibits a powerful anti-apoptotic function that has a role in resistance to cancer treatment (Zhang et al., 2014). In rat testes, clusterin synthesized by Sertoli cells is secreted into the lumen of the seminiferous tubules (Griswold et al., 1988). One recent study has suggested that increased secretion of clusterin by Sertoli cells protects the testes from heat-induced injury in rat testes (Matsushita et al., 2016). This study, however, was restricted to rodents and there was an increase in heat stress of the testes for only a short time. In addition, rodents differ greatly from humans in reproductive anatomy. To our knowledge, no data are available regarding the presence and putative roles of clusterin in the testes of normal and cryptorchid dogs. The aim of the present study, however, was to investigate the expression of the clusterin gene and histological changes in normal and cryptorchid testes. For this purpose, western blot and immunohistochemistry procedures were conducted to study the presence and distribution of these proteins, and real-time RT-PCR to determine the relative abundance of mRNA in normal and cryptorchid testes of dogs. 2. Materials and methods 2.1. Animals and surgical procedures The experimental protocol was approved by the Institutional Animal Care and Use Committee at Konkuk University (KU17146). Six male mongrel dogs were used in the present study. Unilateral cryptorchidism was surgically induced as previously described (Lee et al., 2016b). Experimental dogs received acepromazine (0.1 mg/kg; IM) for premedication and Propofol (6 mg/kg; IV) for induction of inhalation anesthesia. Endotracheal intubation with an internal diameter 7-mm tube was performed and anesthesia was maintained via the inhalation of a combination of 2% isoflurane and oxygen. Each animal was administered cefazolin sodium (22 mg/kg; IM) at the time of induction of anesthesia. Physiologic monitoring of dogs during surgery and anesthesia included continuous pulse oximetry, ECG, and measurements of blood pressure variables, heart and respiratory rates, and body temperature via an esophageal probe. Meloxicam (0.1 mg/kg; SC) was used as pre- and postoperative analgesic. Anesthesia and surgery for dogs used in all experiments were performed by an experienced veterinarian. A 4-cm long paramedian incision was made through the skin in the inguinal region. The superficial and internal inguinal ring was exposed and enlarged by incising it, the gubernaculum on the right side was cut to displace the testis into the abdomen, and the inguinal canal was closed. Sham surgery occurred on the contralateral testis so that it would function as a paired control. Laparoscopic cryptorchid testes biopsy was performed every week for 1 month. Experimental dogs were euthanized 30 days after surgery. Abdominal and scrotal testes were removed and decapsulated. The testes and cauda epididymis were stored at −80 °C for RT-PCR and western blotting analysis and kept in 4% formaldehyde solution for histological and immunohistochemical analysis. 2.2. Hematoxylin and eosin staining Samples were subsequently washed with 70% and 100% (v/v) ethanol, embedded in paraffin, sliced into 5-μm thick sections using a microtome (Thermo; Barrington, IL, USA), and mounted on glass slides. The mounted dog testis tissue was rehydrated with xylene and 100% ethanol. The nuclei and cytoplasm of the rehydrated testes were stained with hematoxylin and eosin. Hematoxylin and eosin-stained tissue slides were analyzed using a microscope (Olympus IX73, Tokyo, Japan) provided with an eXcope camera (×200) to take photographs of the slides. The diameter of seminiferous tubules was analyzed by eXcope image analysis software; at least 10 seminiferous tubules in six different testes were used for these measurements. 2.3. RNA extraction, RT-PCR and real-time PCR The RNA was extracted from three different regions in normal and cryptorchid dog testes using the Qiagen RNA extraction kit following instructions by the manufacturer (74104; Qiagen, Venlo, Netherlands). Genomic DNA was removed by treatment with DNase I according to instructions by the manufacturer (Qiagen). The cDNA was synthesized from 1 μg of total RNA using the RT-PCR premix kit (15131; iNtRON, Seongnam, South Korea). The PCR amplification of the target gene was performed with 25 to 30 cycles of 30 s at 95 °C, 30 s at 55 °C, and 30 s at 72 °C. The primers used for determining relative abundances of clusterin mRNA are listed in Table 1 Primers used for reverse transcription-polymerase chain reaction of cDNA from dog testis. Gene Forward Primer Reverse primer Canine GAPDH Canine Clusterin1 Canine Clusterin2 5'- CTTCACCACCATGGAGAAGG -3' 5'- CGGAGAAGTTCACCAAGCTC -3' 5'- TCATGCAGGACAGCTTCAAC -3' 5'- CAGCTCAGGGATGACCTTGC -3' 5'- CCCAGCTAAACTGCTCGTTC -3' 5'- AGGGCTGGAATCTAGGGAAA -3' 159 Animal Reproduction Science 193 (2018) 158–164 H. Jhun et al. Table 1. The relative amounts of putative clusterin mRNAs were estimated in duplicate samples by fluorescence and quantified using Qiagen Rotor-Gene PCR detection system. The reaction was initiated in a total volume of 20 μL, which contained 10 ng of cDNA and 1 pM of each primer set in a reaction buffer containing iQ SYBR Green Supermix (170-8880; Bio-Rad Laboratories). The cycle threshold (Ct) values were normalized as compared with abundance of GAPDH mRNA. The results were expressed as target gene abundance relative to control gene abundance of mRNA. The PCR amplification was performed with 40 cycles of 20 s at 95 °C, 20 s at 55 °C, and 20 s at 72 °C with the same primer sets used for real-time PCR. 2.4. Western blotting Total protein from dog testes was isolated using a Proprep kit (17081; iNtRON, Seongnam, South Korea), according to manufacturer instructions. Total protein (50 μg) from each sample were separated by 4% to 20% gradient SDS-polyacrylamide gel electrophoresis (Bio-Rad Laboratories, Hercules, CA, USA) and transferred to polyvinylidene fluoride membranes. The membranes were blocked with 5% non-fat milk and incubated for 1 h at room temperature with the following primary antibodies for each protein: Clusterin (1:1000 dilution; SC-166831; Santa Cruz Biotechnology), cleaved caspase-3 (1:1000 dilution; #9664; Cell Signaling), cleaved caspase-8 (1:1000 dilution; #9496; Cell Signaling) and β-actin (1:5000 dilution; SC-47778; Santa Cruz Biotechnology). After washing three times with Tris-buffered saline-Tween, goat anti-mouse IgG-HRP (1:1000 dilution; SC-2005; Santa Cruz Biotechnology) and goat anti-rabbit IgG-HRP (1:1000 dilution; SC-2004; Santa Cruz Biotechnology) antibodies were added for 2 h at room temperature and protein expression was confirmed using enhanced chemiluminescence (32106; Thermo Fisher SCIENTIFIC, Waltham, MA, USA). 2.5. Immunohistochemistry To locate clusterin-containing cells in the dog testes, the antigen was retrieved by boiling the tissue for 30 min in Tris-EDTA acid solution (10 mM Tris base, 1 mM EDTA, and 0.05% Tween-20; pH 9). The membranes of the antigen-retrieved tissues were permeabilized with phosphate-buffered saline (PBS) containing 0.2% Triton X-100, for 10 min. Non-specific protein binding was blocked with 2% bovine serum albumin in PBS for 1 h at room temperature. Tissues were incubated overnight at 4 °C with clusterin (1:50 dilution) antibody. After washing three times with Tris-buffered saline-Tween, the goat anti-mouse IgG-HRP (1:1000 dilution; SC2005; Santa Cruz Biotechnology) antibody was added for 2 h at room temperature. Peroxidase substrate detection kit (SK-4100; Vector Laboratories; Burlingame, CA, USA) was used for the detection of clusterin according to manufacturer instructions. To identify nuclei, hematoxylin was used for counter staining. 2.6. Statistical analysis The data for seminiferous tubule diameters and relative abundance of clusterin mRNA were analyzed by one-way analysis of variance (ANOVA) using the SPSS statistical package version 21.0 for Windows. Between-group comparisons were performed using one-way nested ANOVA followed by Tukey´s test. All data presented are means ± standard deviation. The null hypothesis was rejected when the probability was P < 0.05. 3. Results 3.1. Histological analysis of heat-damaged dog testes To determine whether surgically induced cryptorchidism in dog testes was successful, H&E staining was performed. Spermatozoa were not found in cryptorchid testes nor in the cauda epididymis (Fig. 1B). The diameter of the seminiferous tubule in cryptorchid dog testes was significantly reduced, compared to wild-type dog testes (Fig. 1B, C). 3.2. Novel gene screening of cryptorchid dog testes Screening of relative abundance of mRNA for genes with relatively greater expression was performed as previously described (Lee et al., 2016a). The present study revealed a 12.8-fold greater relative abundance of clusterin mRNA in cryptorchid compared with intact dog testes (Table2). 3.3. Quantification and analysis of clusterin in cryptorchid dog testes . Abundance of clusterin was greater in heat-damaged compared to intact dog testes (Fig. 2A, B). Abundance of clusterin and cleaved caspase-8 protein were also greater in heat stressed cryptorchid as compared with intact dog testes (Fig. 2C). 3.4. Localization of clusterin in cryptorchid dog testes Immunohistochemistry and counter staining were performed to evaluate presence and localization of clusterin in cryptorchid dog testes. Clusterin was in significantly greater amounts in cryptorchid dog testes (Fig. 3A) and it was also detected in extracellular 160 Animal Reproduction Science 193 (2018) 158–164 H. Jhun et al. Fig. 1. Morphological differences between control and surgically-induced cryptorchidism in dog testes and cauda epididymis. (A and B) Hematoxylin and eosin staining results at 30 days after surgery. (C) Comparison of seminiferous tubule diameter of dog testes. Data shown are means ± SD. *** P < 0.01, compared with the control. Arrow indicates sperm. The scale bars indicate 100 μm (×200). Table 2 Clusterin that was over expressed in cryptorchid dog testes compared with wild type dog testes. Temp ID transcript_ID gene description cryptorchidism/wild type (fold) rna42156 NP_001003370.1 CLU clusterin 12.860345 regions (Fig. 3B). 4. Discussion Low temperature of mammalian testes is essential for spermatogenesis. Greater than typical heat-stress of testes results in 161 Animal Reproduction Science 193 (2018) 158–164 H. Jhun et al. Fig. 2. Abundance of clusterin compared between control and surgically-induced cryptorchidism in dog testes. (A) RT-PCR analysis of clusterin. (B) Real time RT-PCR analysis of clusterin. (C) Western blotting analysis of clusterin and apoptotic markers. Data shown are s means ± SD. *** P < 0.01, compared with the control. Arrow indicates clusterin positive cells. The scale bars indicate 100 μm (×200). testicular cell apoptosis leading to reduced seminiferous tubular diameter and luminal volume, as well as partial loss of pachytene spermatocytes and round spermatids (Lue et al., 2000). In rodents, the testes communicate with the abdominal cavity through inguinal canals which remain open throughout life. In contrast, in humans and dogs, inguinal canals are normally closed after descent of the testes from the abdomen into the scrotum after birth (Treuting and Dintzis, 2011). In a previous study surgically-induced cryptorchidism in dogs significantly reduced spermatic cells (include spermatogonia, spermatocyte, spermatid, and spermatozoa), but not Sertoli cells (Lee et al., 2016b). The use of surgically-induced cryptorchidism resulted in similar responses as what occurs naturally in cryptorchidic animals. In the present study, germ cell-specific apoptosis and expression of the clusterin gene occurred in testes of surgically-induced cryptorchid dogs. Clusterin was not detected in dog testes where the cryptorchid state was not induced; whereas, was markedly abundant in cryptorchid dog testes. This result was not observed in previously reported studies involving rodents, in which case, although the expression of the clusterin gene was greater in heat-stressed testes, it was also detected in testes where the cryptorchidic state did not exist (Matsushita et al., 2016). A previous report described that extracellular clusterin promoted epithelial cell apoptosis; whereas, intracellular clusterin maintained epithelium viability during lung repair (Habiel et al., 2017). Additionally, clusterin reportedly inhibited apoptosis by interfering with Bax activation in mitochondria (Zhang et al., 2005). Furthermore, elevated expression of the clusterin gene in sertoli cells promoted the protection of testes from heat-induced injury in rat testes (Matsushita et al., 2016). In the present t study, immunohistochemistry results indicate clusterin is present in the extracellular region of cryptorchid dog testes. This result indicates that elevated clusterin in cryptorchid dog testes may promote apoptotic signaling in cryptorchid testes. Apoptosis occurs through a tightly-regulated cascade of caspase activation. In receptor-mediated programmed cell death, caspase3 is considered a major inhibitor of protease, while caspase-8 has the most important role in transduction of apoptotic signals (Said et al., 2004). A previous report described an increase in the proportion of cells expressing the caspase-3 gene following a transient increase to 42 °C for 30 min of mouse testes (Paul et al., 2009). In another study the amount of caspase-8 in plasma was inversely and significantly related to sperm concentration (Wei et al., 2014). The present study has demonstrated germ cell-specific death is associated with expression of the caspase-3 and -8 genes in cryptorchid dog testes. This result suggests that apoptosis of male germ cells was induced by heat stress in cryptorchid testes. In conclusion, in the present study cryptorchid-induced heat stress led to germ cell apoptosis in dog testes. Furthermore, this effect of cryptorchidism was accompanied by a significant increase in extracellular clusterin. These findings suggest that increases in extracellular clusterin in response to heat stress induced apoptotic cell death in cryptorchid dog testes. 162 Animal Reproduction Science 193 (2018) 158–164 H. Jhun et al. Fig. 3. Localization of clusterin in normal and cryptorchid dog testes 4 weeks after surgery. (A) Immunohistochemistry analysis of normal and induced cryptorchidism dog testes. (B) Counter staining of clusterin in dog testes. Arrows indicate clusterin presence. The scale bars indicate 100 μm (×200). 163 Animal Reproduction Science 193 (2018) 158–164 H. Jhun et al. Conflict of interest None of the authors have any conflict of interest to declare. Funding This study was supported by the Cooperative Research Program for Agriculture Science & Technology Development, Rural Development Administration, Republic of Korea (grant number PJ011865). References Blaschuk, O., Burdzy, K., Fritz, I.B., 1983. Purification and characterization of a cell-aggregating factor (clusterin), the major glycoprotein in ram rete testis fluid. J. Biol. Chem. 258, 7714–7720. Cai, H., Ren, Y., Li, X.X., Yang, J.L., Zhang, C.P., Chen, M., Fan, C.H., Hu, X.Q., Hu, Z.Y., Gao, F., Liu, Y.X., 2011. Scrotal heat stress causes a transient alteration in tight junctions and induction of TGF-β expression. Int. J. Androl. 34, 352–362. Griswold, M.D., Morales, C., Sylvester, S.R., 1988. Molecular biology of the Sertoli cell. Oxf. Rev. Reprod. Biol. 10, 124–161. Habiel, D.M., Camelo, A., Espindola, M., Burwell, T., Hanna, R., Miranda, E., Carruthers, A., Bell, M., Coelho, A.L., Liu, H., Pilataxi, F., Clarke, L., Grant, E., Lewis, A., Moore, B., Knight, D.A., Hogaboam, C.M., Murray, L.A., 2017. Divergent roles for clusterin in lung injury and repair. Sci. Rep. 7, 15444. Lee, W.Y., Do, J.T., Park, C., Kim, J.H., Chung, H.J., Kim, K.W., Gil, C.H., Kim, N.H., Song, H., 2016a. Identification of putative biomarkers for the early stage of porcine spermatogonial stem cells using next-generation sequencing. PLoS One 11, e0147298. Lee, W.Y., Lee, R., Song, H., Hur, T.Y., Lee, S., Ahn, J., Jhun, H., 2016b. Establishment of a surgically induced cryptorchidism canine recipient model for spermatogonial stem cell transplantation. Lab. Anim. Res. 32, 257–266. Lue, Y., Hikim, A.P., Wang, C., Im, M., Leung, A., Swerdloff, R.S., 2000. Testicular heat exposure enhances the suppression of spermatogenesis by testosterone in rats: the "two-hit" approach to male contraceptive development. Endocrinology 141, 1414–1424. Matsushita, K., Miyake, H., Chiba, K., Fujisawa, M., 2016. Clusterin produced by Sertoli cells inhibits heat stress-induced apoptosis in the rat testis. Andrologia 48, 11–19. Mieusset, R., Fouda, P.J., Vaysse, P., Guitard, J., Moscovici, J., Juskiewenski, S., 1993. Increase in testicular temperature in case of cryptorchidism in boys. Fertil. Steril. 59, 1319–1321. Paul, C., Teng, S., Saunders, P.T., 2009. A single, mild, transient scrotal heat stress causes hypoxia and oxidative stress in mouse testes, which induces germ cell death. Biol. Reprod. 80, 913–919. Rosenberg, M.E., Silkensen, J., 1995. Clusterin: physiologic and pathophysiologic considerations. Int. J. Biochem. Cell Biol. 27, 633–645. Said, T.M., Paasch, U., Glander, H.J., Agarwal, A., 2004. Role of caspases in male infertility. Hum. Reprod. Update 10, 39–51. Serrano, T., Chevrier, C., Multigner, L., Cordier, S., Jégou, B., 2013. International geographic correlation study of the prevalence of disorders of male reproductive health. Hum. Reprod. 28, 1974–1986. Treuting, P.M., Dintzis, S.M., 2011. Comparative Anatomy and Histology 1st Edition: A Mouse and Human Atlas. Academic Press. Wei, X., Li, Q., Han, Z., Lin, D., Yu, P., 2014. Differences in caspase-8 and -9 activity and sperm motility in infertile males of Li nationality in China. Int. J. Clin. Exp. Med. 8, 4721–4726. Wong, P., Borst, D.E., Farber, D., Danciger, J.S., Tenniswood, M., Chader, G.J., van Veen, T., 1994. Increased TRPM-2/clusterin mRNA levels during the time of retinal degeneration in mouse models of retinitis pigmentosa. Biochem. Cell Biol. 72, 439–446. Zhang, F., Kumano, M., Beraldi, E., Fazli, L., Du, C., Moore, S., Sorensen, P., Zoubeidi, A., Gleave, M.E., 2014. Clusterin facilitates stress-induced lipidation of LC3 and autophagosome biogenesis to enhance cancer cell survival. Nat. Commun. 5, 5775. Zhang, H., Kim, J.K., Edwards, C.A., Xu, Z., Taichman, R., Wang, C.Y., 2005. Clusterin inhibits apoptosis by interacting with activated bax. Nat. Cell Biol. 7, 909–915. 164
0
Puede agregar este documento a su colección de estudio (s)
Iniciar sesión Disponible sólo para usuarios autorizadosPuede agregar este documento a su lista guardada
Iniciar sesión Disponible sólo para usuarios autorizados(Para quejas, use otra forma )