Subido por Nadya Yanet Cortés Álvarez

PCR

Anuncio
7.8.5 PCR en tiempo real
Para detectar los genes encargados de la expresión de rGABAA y rAMPA se
realizará una PCR en tiempo real con los siguientes pasos:
1. Extracción de ARN
Se tomarán de 50 a 100 mg de tejido de amígdala o hipocampo y se lavará 2
veces con PBS 0.1M. Una vez lavado, el tejido se trasferirá a tubos ependorff de 2
ml y se agregará 1 ml de TRIzol® Reagent (Anexo 1) para formar un lisado, una
vez obtenido se incubará 5 min y se añadirá 0.2 ml de cloroformo, para después
mezclarse y dejar reposar durante 2-3 min. Después del reposo se centrifugará a
12000 g durante 15 min a 4oC. Luego se transferirá la fase acuosa a un tubo
limpio ependorff de 2 ml dónde se procederá a la precipitación del RNA mediante
la adición de 0.5 ml de isopropanol. Posteriormente se incubará nuevamente
durante 10 min a temperatura ambiente y se centrifugará a 12000 g durante 10
min a 4oC, de nueva cuenta se transferirá la fase acuosa a un tubo limpio
ependorff de 2 ml. Por último, se realizará un lavado con etanol al 70% y se
centrifugará a 7500 g, 5 min a 4oC. El ARN obtenido se dejará secar hasta que se
evaporé el etanol y el precipitado se observe incoloro. Posteriormente se
resuspenderá en el volumen de 50 ul de H20 (Livak & Schmittgen, 2001).
2. Valoración del ARN
El ARN se determinará midiendo la concentración obtenida en un cuantificador de
ADN/ARN a 260 nm (GeneQuant Pro, RNA/DNA Calculator, ProMega) y
comprobando la integridad del RNA. Para esto se cargará entre 0.5 a 1 g de ARN
de cada muestra en un gel de agarosa 1%.
3. Retro Transcripasa -PCR
Para generar una gran cantidad de copias de ADNc con ARN, se utilizará el kit
SuperScript ® III First-Strand Synthesis System (Invitrogen) para realizar la
reacción en cadena de la polimerasa con transcriptasa inversa (RT-PCR), la cual
actúa como una retrotranscripta para convertir el ARN a ADN complementario
(ADNc) siguiendo las indicaciones del manufacturado (Anexo 2) (Scientific, 2011).
4. PCR en tiempo real y expresión de Graba2 y Gria1
Para la cuantificación relativa se llevará a cabo una PCR en tiempo real, cuya
reacción consistirá en un volumen total de 10 microlitros (μl), conteniendo: 1X de
Master Mix (FastStarTM Taq DNA polimerasa, buffer de reacción, MgCl2 y una
mezcla de los dNTPs), 0.5 μl de cada primer, 1 μl de cDNA y la cantidad de H 2O
inyectable necesaria para completar 10 μl de mezcla total, donde se emplearán los
primers (tabla 6):
Gen
Primer
Tamaño del
producto
Gria1
“glutamate ionotropic
receptor AMPA type
subunit 1”
Left: TCTGTCTTCTGTGGCGTGAC 145 pb
Right:
ATGCCCCTTGTAAGCAACAC
Gene ID: 50592
Gabra2
“gamma-aminobutyric
acid type A receptor rho 2
Left: GGCCTGTTCTTTCACATGGT
Right:
ATCCTGCAGACAGAGGCAGT
127 pb
subunit”
Gene ID: 29695
Gapdh
Left:CACTGAGCATCTCCCTCACA
glyceraldehyde-3phosphate
dehydrogenase
Right:AGAGGGTGCAGCGAACTTTA
108 pb
Gene ID: 24383
Tabla 6. Primers. Primers a utilizar en la PCR en tiempo real (3).
La amplificación y detección será desarrollada utilizando el termociclador
CFX96 TouchTM Real-Time PCR BioRad con siguiente programación: preincubación 1 ciclo a 95 °C , 10 min; amplificación y cuantificación 35 ciclos a 95°C,
10 seg., 60 °C 20 seg., 72 °C, 1 seg.; Enfriamiento 1 ciclo 40 °C, 30 seg. El
análisis de datos por real-time PCR, fue mediante el software CFX ManagerTM
Software 1845000. Versión 3.1.
Anexo 1. Reactivo TRIzolTM
Protocolo experimental para la aislación de ADN.
Procedimiento:
1. Realizar todos los procedimientos a temperatura ambiente (20°C-25°C).
2. Usar el reactivo TRIzolTM si el material contiene altos niveles de RNasas,
como bazo y páncreas.
3. Usar material plástico desechable y estéril.
4. Usar guantes desechables mientras se manejan los reactivos y muestras de
RNA para evitar la contaminación de las RNasas.
Para aislamiento de ADN:
1. Después del lisado, remover cualquier residuo acuoso de la interfase.
2. Agregar 0.3ml de etanol al 100% por cada ml de TRIzolTM usado para lisis.
3. Cerrar el tubo mediante la mezcla invirtiendo el tubo varias veces.
4. Incubar de 2 a 3 min.
5. Centrifugar por 5min a 2000xga 4°C.
6. Transferir la suspensión etanol-fenol a un nuevo tubo.
7. La suspensión se utiliza para el aislamiento de la proteína (Puede
almacenarse a -70°C por varios meses).
Lavado del ADN:
1. Resuspender el pellet en 1ml de citrato de sodio a 0.1M en 10% de
etanol, con un pH de 8.5, por cada ml de TRIzolTM usado para la lisis.
2. Incubar por 30min mezclando ocasionalmente por inversión.
3. Centrifugar por 5min a 200xg a 4°C
4. Descartar el sobrenadando con micropipeta.
5. Repetir los pasos 1 y 4 una vez (2 veces por pellets del doble de largo).
6. Resuspender el pellet en 1.5 a 2ml de etanol al 75% por cada ml de
TRIzolTM usado para la lisis.
7. Incubar de 10 a 20 min mezclado gentilmente.
8. Centrifugar por 5min a 200xg a 4°C
9. Descartar el sobrenadando con micropipeta.
10. Secar con aire el pellet de ADN de 5 a 10min. (no usar centrífuga)
Solubilizar el ADN:
1. Resuspender el pellet en 0.3-0.6 ml de 8mMNaOH pipeteando de arriba
abajo.
2. Centrifugar por 10min a 12,000xg a 4°C para remover materiales
insolubles.
3. Transferir el sobreflotante a un tubo nuevo y medir el pH.
Anexo 2. Kit SuperScript ® III First-Strand Synthesis System (Invitrogen)
Materiales necesarios:
a. 2ml de agua desionizada libre de RNasas
b. Vortex
c. Termociclador con configuración a 65°C (CFX96- BioRad)
d. Centrífuga
e. Muestra: 5 µg de RNA (n µ/L)
f. Primer (50µM oligo (dT) o 2 µM primer del gen específico (1 µ/L)
g. Tapom Buffer (1µ/L)
Procedimiento:
1. Mezclar y centrifugar de manera breve las sustancias antes de usarlas.
2. Precalentar el termociclador a 65°C
3. Combinar los reactivos e,f,g y a en un tubo de PCR de 2ml con paredes
delgadas y conservar a 4°C.
4. Incubar en termociclador a 65 ° C durante 5 minutos y colocar sobre hielo al
menos 1 minuto.
5. Agregar 10 µ/L de Reactivo Mix 2x First-Strand
6. Agregar 2 µ/L de mezcla de enzimas SuperScript II RNAasa OUT
7. Mezclar en el vortex de manera breve.
8. Incubar durante 50min a 50°C en Oligo (dT) 20 o GSP cebado
9. Incubar el primer durante 5 a 10 minutos a 25 ° C seguido de 50 minutos a
50 ° C
10. Terminar las reacciones a a 85 ° C durante 5 minutos.
11. Enfriar la reacción de síntesis de cDNA en hielo y almacenar a 20°C o
proceder con la PCR.
Descargar
Fichas aleatorios
Prueba

4 Tarjetas Arthas Quinzel

tarjeta del programa pfizer norvasc

0 Tarjetas joseyepezsumino

tarjeta del programa pfizer norvasc

0 Tarjetas joseyepezsumino

“DIDÁCTICA PASADO Y PRESENTE

0 Tarjetas BENILDA RINCON PEÑA

“DIDÁCTICA PASADO Y PRESENTE

4 Tarjetas BENILDA RINCON PEÑA

Crear fichas