genetic material recovery of streptococcus mutans from

Vetera corpora morbo afflicta
Actas del XI Congreso Nacional de Paleopatología
Malgosa A, Isidro A, Ibáñez-Gimeno P, Prats-Muñoz G (eds.) (2013)
ISBN: 978-84-940187-5-6. p 699-710
GENETIC MATERIAL RECOVERY OF STREPTOCOCCUS MUTANS
FROM ARCHAEOLOGICAL REMAINS
Simón M1, Smerling A1, Montiel R2, Malgosa A1
1
Unitat d’Antropologia Biològica, Universitat Autònoma de
Barcelona, 08193, Cerdanyola del Vallès, Barcelona
2
Laboratorio Nacional de Genómica para la Biodiversidad,
CINVESTAV-IPN. Km. 9.6 Libramiento Norte Carretera Irapuato –
León. Irapuato, Guanajuato, México
Correspondencia a: [email protected]
RESUMEN. Hemos amplificado ADN de Streptococcus mutans de 6
individuos de distinta antigüedad pertenecientes a la región variable
del gen de la dextranasa y de los continentes Europeo y Americano
con el objetivo de poder caracterizar las posibles diferencias
geográficas y temporales que puedan reflejar su evolución y
mecanismos de adaptación a su huésped humano. Se ha logrado
obtener una muestra perteneciente a la Edad de Bronce en
Catalunya. El tamaño muestral es aún insuficiente para extraer
conclusiones significativas, aunque se puede observar que la
posición 367 ya era polimórfica antes de los contactos entre ambos
continentes y parece que la citosina es el nucleótido ancestral en la
posición 437.
699
Simón et al.
PALABRAS CLAVE: Dextranasa, Streptococcus mutans, Edad de
Bronce
ABSTRACT. We have amplified DNA from Streptococcus mutans
from 6 individuals of different antiquity belonging to the variable
region of the dextranase gene and from the European and American
continents with the purpose of characterizing the possible
geographic and temporary differences that can reflect their
evolution and adaptation to its human host. It has been possible to
obtain a sample belonging to the Bronze Age in Catalonia. The
sample size is not enough to draw significant conclusions, even
though it can be observed that position 367 was already
polymorphic before the contact between the two continents and it
seems that citosine was the ancestral nucleotide at position 437.
KEYWORDS: Dextranase, Streptococcus mutans, Bronze Age
INTRODUCTION
Dental diseases have been widely overlooked along history at the
time of explaining population dynamics in past populations,
especially caries, the most widely extended buccal lesion, that is
caused by Streptococcus mutans (S. mutans). The aim of this work is
to start correcting this bias, the first step being the understanding of
this microorganism’s evolution.
(a) Streptococcus mutans’ characteristics
This is the Gram-positive bacterium able to metabolize a widest
variety of carbohydrates. It carries out a non-oxidative fermentation
of these molecules, one of its major by-products being the lactic
acid, that dissolves the enamel and thus can propitiate the caries
(Quivey et al., 2001; Walsh, 2006). Owing to the acidification of the
local environment, it inhibits its competitors because it has an acidstable membrane (Hamilton and Svensäter, 1998). The multilayer
peptidoglican net, that does not have an external membrane, shows
a high resistence to physical rupture and dry conditions, both of
which favour its preservation (Quivey et al., 2001).
700
Simón et al.
Apart from being the only species that has consistently been linked
to human caries (Lindhe, 2001; Ajdic et al., 2002; Sato et al., 2003),
it has recently been linked to heart problems (Janket et al., 2003).
One of the systems used to classify the different strains of the
microorganism is in groups called serotypes according to the
biochemical characteristics of a peptidoglican chain that has a
variable amount of glucose residues (serotypes c, e and f, Loesche,
1986) or a lack of them (serotype k, Nakano et al., 2004). Serotype c
seems to be the most ancient and frequent one, and the
appearance of the other three point to an evolution towards a
reduction of its cariogenicity in favour of an increment in its sistemic
virulence. No particular geographic distribution has been identified
so far.
According to the available data, its mode of evolution seems to be
via horizontal transmission with an intraspecific genomic
recombination, and its pattern of inheritance is matrilineal,
although with a great degree of variation in percentage among
individuals. A 5% of S. mutans populations bear a plasmid (Macrina
and Scott, 1978) whose evolution does not parallel that of the rest
of its chromosome (Caufield et al., 2007). So these data support that
human beings, the bacteria and their plasmid have some
characteristics typical of coevolution and others typical of
independent evolution.
It has also been observed a variation in its morphotypes according
to its host pattern of subsistence.
For this work, it is worth mentioning its production of the
dextranase enzyme, a so-called virulence factor. It accumulates in
the teeth via the accumulation of extracellular glucans synthesized
from a sucrose molecule. This enzyme hydrolizes glucans, thus
providing nutrients to the dental plaque bacteria (Colby et al. 1995;
Igarashi et al., 2001, 2002), and modifies S. mutans molecular
structure making its ligation to the plaque more adhesive (Igarashi
et al., 2001, 2002; Morisaki et al., 2002).
Preceeding this study, a member of our team showed that it was
possible to recover S. mutans DNA from ancient remains (Smerling
et al., 2005).
701
Simón et al.
(b) Aims of the study
The purpose of this study was to obtain S. mutans genetic material
of samples that encompass from the Late Bronze Age to the XVth
century in both the European and the American continents for
ulterior studies, putting ready for the first time a protocol for its
recovery from ancient remains.
The pretention is to know wether its so-called virulence factors, as
the one that codifies for the dextranase gene, have evolved along
time.
Finally, this study wants to check if the samples present at the New
World show significant differences before and after the European
colonization.
(c) Ancient DNA problematics
Normally, as a consequence of the passing of time and the damage
that the genetic material suffers as a consequence to the exposure
to various physical and chemical substances, the amount of DNA
suitable for the amplification of amplicons of a correct size is very
low. Moreover, UV iradiation or radicals present as a consequence
of the oxidation can chemically modify the components of the DNA
molecule, thus modifying the original sequence and creating
modified, artificial ones. This is why repetibility in these studies is so
important. A high amount of substances can, too, be inhibitory to
the PCR reaction.
A major problem in ancient DNA studies is the sample
contamination with DNA coming from external sources, mainly from
people that have manhandled them or by cross-contamination with
samples previously treated at the same laboratory.
Very strict measures are, though, ineludible:
• Sterility: there has to be a physical isolation between the pre
and postPCR areas, the conditions in the former must be of
strict sterility and all the processes must be done with
extreme care.
• Whenever possible, depending on the sample number and
conservation conditions, a percentage of the samples have to
702
Simón et al.
be duplicated, both at the same laboratory and in an outer
one.
• Samples must make phylogenetic sense and a certain degree
of diversity is a support for the authenticity of the results.
So to authenticate the results, the recommended criteria
concerning sterility, use of negative controls, reproducibility,
clonation and diversity of the results were fulfilled. The flexibility
and the intelligent use of these criteria were applied (Pääbo et al.,
2004; Gilbert et al., 2005; Montiel et al., 2007).
The BLAST program (Altschul et al., 1997) was used in GenBank
database (NCBI) to compare the sequences.
MATERIAL AND METHODS
Samples were stored and amplified in the laboratory of
palaeogenetics at the Universitat Autònoma de Barcelona.
Conditions of sterility and the suitable precautionary measures
were previously described elsewhere (Malgosa et al., 2005)
A pair of primers from a segment from the dextranase gene that did
not show homology with any other species were designed (Smerling
et al., 2005), discarding the possibility of coamplification with any
other microorganism, using the program BLASTN 2.2.9 in GenBank
(Altschul et al., 1997) (Table 1). Specifically, an 84bp region from the
N-terminal hypervariable segment was amplified.
TABLE 1. Sequences of the primers used to amplify the 84bp studied
segment
L-344: 5’- CGGCTGAACCAGCTATTAGG -3’
Primer
sequences
(Smerling, 2004)
R-467: 5’- GACGCCGATTCTGTCTGTAC -3’
(Smerling, 2004)
Samples were carefully selected, diagnosing caries by the
observation of dental pieces.
703
Simón et al.
The extraction method was the phenol-clorophorm method used
routinely at our laboratory (Malgosa et al., 2005). The amplification
process consisted in an initial denaturation step at 94ºC, followed
by 45 cycles of PCR, including 10 sec at 94ºC, 30 sec at the adequate
annealing temperature, and a final high-resolution melting step.
Individuals used were from different origins and periods (Table 2).
TABLE 2. Origin and antiquity of the samples that were succesfully
sequenced and the modern-day reference used
Haplotip
Situation
Age
North America
Modern
MO
Montanissell, Lleida
Bronze Age
CR
Can Reiners, Majorca
VIIth cent
SP
Sant Pere Churches, Catalonia
V-XIIth cent
UA
Catalonia
XXth cent
TL
Tlatelolco, Mexico
U159
1
2
3
4
5
Pre-cont XV-XVIth
cent
LO
Los Olmos, Mexico
6
Post-cont XVIth cent
6
1
Pre-cont: pre-contact; Post-cont:post-contact; cent: century. Ajdic et al., 2002;
2
3
4
5
6
Simón et al., 2011; Díaz, 2009; Jordana, 2007; UAB collection; Solórzano, 2006.
RESULTS
6 samples of 84bp were obtained, 4 from Europe (1 from the Bronze
Age, 2 from the Middle Ages and 1 from the beginning of the XXth
century), and 2 from America (1 from the XVth century, before the
colonization process, and 1 from the XVIth century after it). The
obtained sequences were aligned, together with a modern strain
used as a reference (UA159, an American Strain, Ajdic et al., 2002)
(Table 3).
704
.
.
.
.
SP
UA
TL
LO
.
MO
.
T
U159/AEO 14133
CR
364
Str./Acc. nr.
705
.
A
A
.
A
.
G
367
.
.
.
.
.
.
C
368
.
.
.
.
.
.
G
370
.
.
.
.
.
.
A
380
.
.
.
.
.
.
T
390
.
.
.
.
.
.
C
400
.
.
.
.
.
.
A
410
.
.
.
.
.
.
G
420
.
.
.
.
.
.
G
429
TABLE 3. Sequences obtained alligned with a modern-day reference
.
.
.
.
.
.
G
430
C
C
C
C
C
C
T
437
.
.
.
.
.
.
C
440
.
.
.
.
.
.
A
447
Simón et al.
Simón et al.
There is an A to G transition at three of the samples at nucleotide
position 367, and one of them is in an American sample preceding
the European colonization, so this variation was already present in
both Europe and America before this contact. The transition from C
to T at position 437 that appears in the modern American sample
has not yet been observed in the ancient samples, neither in the
other modern samples sequenced so far (data not shown), so a C
seems to be the ancestral nucleotide at this position.
CONCLUSIONS
As no positive controls and no S. mutans DNA had been previously
used at our laboratory, we can verify the authenticity of our results
and confirm that the isolation of DNA from this microorganism is
possible in archaeological remains.
Having recovered DNA from a sample belonging to the Bronze Age,
it can also be established that this method is suitable to obtain
positive results in prehistoric samples. More samples will be needed
in order to know the evolution pattern of the virulence factors of S.
mutans.
Purposes for the future
Considering the obtained results, it seems legit to think that in a few
time palaeogenetics will be able to answer some of the following
questions in the near future:
• Were there changes in these bacteria when human beings
moved from the hunter-gathering to the farming way of life?
• Is S. mutans’ philogeny parallel to the one of its human host?
What kind of evolution has this microorganism gone through?
Do different ethnies relate to different paces in its evolution?
• At what rythm has the bacterium been acquiring resources to
adapt to the oral and cardiac environment of its host?
• When and why did some strains acquire a plasmid?
• Are the serotypic characteristics in Europe and America
homogeneous?
706
Simón et al.
This is just the starting point for the study of the palaeogenetics of
this organism.
BIBLIOGRAPHY
Ajdic D, McShan WM, McLaughlin RE, Savic G, Chang J, Carson MB,
Primeaux C, Tian R, Kenton S, Jia H, Lin S, Qian Y, Li S, Zhu H, Najar F, Lai H,
White J, Roe BA, Ferretti JJ. 2002. Genome sequence of Streptococcus
mutans UA159, a cariogenic dental pathogen. P Natl Acad Sci USA
99:14434–14439.
Altschul SF, Madden TL, Schäffer AA, Zhang J, Zhang Z, Miller W, Lipman
DJ.1997. Gapped BLAST and PSI-BLAST: A new generation of protein
database search programs. Nucl Acid Res 25:3389-3402.
Caufield PW, Saxena D, Fitch D, Li Y. 2007. Population structure of plasmidcontaining strains of Streptococcus mutans, a member of the human
indigenous biota. J Bacteriol 189:1238-1243.
Colby SM, Whiting GC, Tao L, Russell RRB. 1995. Insertional inactivation of
the Streptococcus mutans dexA (dextranase) gene results in altered
adherence and dextran catabolism. Microbiology 141:2929-2936.
Díaz N. 2009. Bahía de Alcúdia, Mallorca: Un crisol genético en el
Mediterráneo. PhD Thesis. Barcelona: Universitat Autònoma de Barcelona.
Gilbert MT, Bandelt HJ, Hofreiter M, Barnes I. 2005. Assessing ancient DNA
studies. Trends Ecol Evol 20:541-544.
Hamilton IR, Svensäter G. 1998. Acid-regulated proteins induced by
Streptococcus mutans and other oral bacteria during acid shock. Oral
Microbiol Immun 13:292-300.
Igarashi T, Yamamoto A, Goto N. 2001. Nucleotide sequence and molecular
characterization of a dextranase gene from Streptococcus downei.
Microbiol Immun 45:341-348.
Igarashi T, Morisaki H, Yamamoto A, Goto N. 2002. An essential amino acid
residue for catalytic activity of the dextranase of Streptococcus mutans.
Oral Microbiol Immun 17:193-196.
Jordana X. 2007. Caracterització i evolució d'una comunitat medieval
catalana. Estudi bioantropològic de les inhumacions de les esglésies de
Sant Pere. PhD Thesis. Barcelona: Universitat Autònoma de Barcelona.
Lindhe J. 2001. Periodontología clínica e implantología odontológica.
Madrid: Médica Panamericana.
707
Simón et al.
Loesche WJ. 1986. Role of Streptococcus mutans in human dental decay.
Microbiol Rev 50:353–380.
Macrina FL, Scott CL. 1978. Evidence for a disseminated plasmid in
Streptococcus mutans. Infect Immun 20:296-302.
Malgosa A, Montiel R, Díaz N, Solórzano E, Smerling A, Isidro A, García C,
Simon M. 2005. Ancient DNA: A modern look at the infections of the
past. In: Pandalai SG, editor. Recent research developments in
microbiology. Trivandrum: Research Signpost. p 213-236.
Montiel R, Francalacci P, Malgosa A. Ancient DNA and biological
anthropology: Believers vs. skeptics. 2007. In Santos C, Lima M, editors.
Recent advances in molecular biology and evolution: Applications to
biological anthropology. Kerala: Research Signpost. p 209-250.
Morisaki H, Igarashi T, Yamamoto A, Goto N. 2002. Analysis of dextranbinding domain of the dextranase of Streptococcus mutans. Lett Appl
Microbiol 35:223-227.
Nakano K, Nomura R, Nakagawa I, Hamada S, Ooshima T. 2004.
Demonstration of Streptococcus mutans with a cell wall polysaccharide
specific to a new serotype, k, in the human oral cavity. J Clin Microbiol
42:198-202.
Pääbo S, Poinar H, Serre D, Despres V, Juliane H, Rohland N, Kuch M,
Krause J, Vigilant L, Hofreiter M. 2004. Genetic analyses from ancient DNA.
Annu Rev Genet 38:645-679.
Quivey RG, Kuhnert WL, Hahn K. 2001. Genetics of acid adaptation in oral
streptococci. Crit Rev Oral Biol Med 12:301-314.
Sato T, Matsuyama J, Kumagai T, Mayanagi G, Yamaura M, Washio J,
Takahashi N. 2003. Nested PCR for detection of mutans streptococci in
dental plaque. Lett Appl Microbiol 37:66-69.
Simón M, Jordana X, Armentano N, Santos C, Díaz N, Solórzano E, López JB,
González-Ruiz M, Malgosa A. 2011. The Presence of Nuclear Families in
Prehistoric Collective Burials Revisited. The Bronze Age Burial of
Montanissell Cave (Spain) in the Light of aDNA. Am J Phys Anthropol
146:406-413.
Smerling A. 2004. Análisis de ADN de Streptococcus mutans recuperados
en restos antiguos. DEA Thesis. Barcelona: Universidad de Barcelona.
Smerling A, Chimenos E, Solórzano E, Díaz N, Montiel, R, Malgosa A. 2005.
Analyse de l’ADN de Streptococcus mutans récupéré dans de restes
anciens“. XLIX Congrès du GIRSO, Avr 21-23. Paris: Groupement
708
Simón et al.
Internationale pour la Recherche Scientifique en Stomatologie et
Odontologie.
Janket SJ, Baird AE, Chuang SK, Jones JA. 2003. Meta-analysis of
periodontal disease and risk of coronary heart disease and stroke. Oral
surgery, oral medicine, oral pathology, oral radiology, and
endodontics 95:559-569.
Solórzano E. 2006. De la Mesoamérica Prehispánica a la Colonial: La huella
del DNA antiguo. PhD Thesis. Barcelona: Universitat Autònoma de
Barcelona.
Walsh LJ. 2006. Dental plaque fermentation and its role in caries risk
assessment. Int Dent SA Australasian Edition 1:4-13.
709