Garantía

advertisement
ANEXO II+III:
ESPECIFICACIONES TÉCNICAS + OFERTA TÉCNICA
p 1 /39
Título del contrato: Suministro de Patrones Metrológicos y Equipos de Campo para el Ministerio Agropecuario y Forestal - MAGFOR, Ministerio de
Salud - MINSA y Ministerio de Fomento, Industria y Comercio - MIFIC
Referencia de la publicación: EuropeAid/134420/D/SUP/NI
El Órgano de Contratación deberá completar las columnas n. 1 y 2.
El licitador deberá completar las columnas n. 3 y 4.La Columna 5 se debe dejar vacía para el Comité de Evaluación.
Anexo III – La oferta técnica del licitador
Se pide a los licitadores que completen el modelo de las páginas siguientes:

La columna n.2 la deberá completar el Órgano de Contratación. Muestra las especificaciones requeridas (que no deben ser modificadas por el licitador).

La columna n.3 la deberá completar el licitador y deberá detallar la oferta (por ejemplo, no basta decir "conforme" o "sí")

La columna n.4 permitirá al licitador hacer comentarios sobre el suministro propuesto, así como eventuales referencias a la documentación.
La documentación que eventualmente se presente deberá indicar claramente (subrayado, señal) los modelos ofrecidos y las opciones incluidas, en su caso, a fin de
que los evaluadores puedan ver la configuración exacta. Las ofertas que no permitan identificar de forma precisa los modelos y las especificaciones podrán ser
rechazadas por el Comité de Evaluación.
La oferta deberá ser lo suficientemente clara para permitir a los evaluadores hacer fácilmente una comparación entre las especificaciones requeridas y las
especificaciones ofrecidas.
2013.1
c4f_annexiitechspeciiitechoffer_es
Página 1 de 213
1.
2.
3.
4.
5.
Número
del
artículo
Especificaciones requeridas
Especificaciones ofrecidas
Notas, observaciones,
referencia a la
documentación
Notas del Comité
de Evaluación
LOTE 1 – EQUIPO PARA LABORATORIO DE METROLOGÍA
2013.1
c4f_annexiitechspeciiitechoffer_es
Página 2 de 213
1.
2.
3.
4.
5.
Número
del
artículo
Especificaciones requeridas
Especificaciones ofrecidas
Notas, observaciones,
referencia a la
documentación
Notas del Comité
de Evaluación
PUENTE TERMOMÉTRICO DE ALTA
EXACTITUD PARA LABORATORIOS DE
TERMOMETRÍA (LECTOR DE
TEMPERATURA)
Cantidad: 1 (uno)
Características del Sistema
Exactitud máxima (SPRT Ro ≥ 25 Ω): 0,1 mK
Exactitud (0,01 ºC): 0,025 mK
Incertidumbre de voltaje rango (0 a 20) mV:
250nV
exactitud de corriente: ± 0,4 %
Resolución: 0,001 mK
Estabilidad: ≈ 0,0 ppm/año
TC (factor de resistencia): ≈ 0,0 ppm/ºC
corriente de prueba: 0 a 10 mA (rangos
múltiples)
Rango de resistencia: (0 a 100) kΩ
1
Rango para termopar ± 125 mV
Resistencias de referencia internas: (25, 100,
400) Ω
Estabilidad de resistencias internas: TCR <
0,05 ppm/ºC. Estabilidad anual: < 2 ppm/año
Sondas compatibles: termómetros de
resistencia de platino (2 a 4 hilos), termistores y
termopares
Canales de lectura: 3
Conversiones a temperatura: (PRT: ITS-90)
(Termopar: B,E,J,N,R,S,T,K,Oro-Platino)
(Termistor:Steinhart-Hart)
Puerto de comunicación USB
Tiempo de medición: <2 s
Unidad de medida: Ratio, V, Ohm, °C, °F, K
Estuche protector rígido para transporte
Fuente de entrada (power supply): 88-264V
2013.1
(RMS), 47-63Hz (universal) como máximo 20 W,
c4f_annexiitechspeciiitechoffer_es
1,5 A (RMS) como máximo.
-
Página 3 de 213
1.
2.
3.
4.
5.
Número
del
artículo
Especificaciones requeridas
Especificaciones ofrecidas
Notas, observaciones,
referencia a la
documentación
Notas del Comité
de Evaluación
-
Sistema de conexión eléctrica compatible con
las normas nacionales.
Incluye juego completo de conectores con el
menor efecto térmico EMF posible (plugs, spades,
bare wires, BNC adaptors, etc) para termopares,
resistencia de platino (2 a 4 hilos) y termistores
(longitud de cables mayor que 5 m).
Otros
-
Garantía de 12 meses
Software e interfase lector-PC para adquisición
y gráfica de datos en tiempo real, transferencia de
datos a hoja de calculo de Microsoft Excel, trabaja
con Windows 7 y XP, permite transferencia de
datos vía puerto USB (incluye todos los accesorios
necesarios).
-
REQUISITOS GENERALES
PARA LOS CERTIFICADOS DE
CALIBRACIÓN: para las magnitudes de
resistencia eléctrica y diferencia de potencial con
trazabilidad a las unidades básicas del SI realizado
por un laboratorios primarios (NMI) con mejores
capacidades de calibración (CMC) reconocidas por
el BIPM.
El equipo debe ser instalado y probado en
LANAMET por técnicos debidamente autorizados
por el fabricante. Los equipos de prueba son
suministrados por proveedor.
2013.1
c4f_annexiitechspeciiitechoffer_es
Página 4 de 213
1.
2.
3.
4.
5.
Número
del
artículo
Especificaciones requeridas
Especificaciones ofrecidas
Notas, observaciones,
referencia a la
documentación
Notas del Comité
de Evaluación
BAÑO LÍQUIDO DE CALIBRACIÓN DE ALTA
ESTABILIDAD TERMOSTÁTICAMENTE
CONTROLADO CON SET POINT DIGITAL
Cantidad: 1 (uno)
Características del Sistema
2
-
Rango de trabajo: -30 ºC a 40 ºC
-
Estabilidad máxima: ± 0,6 mK @ 40 ºC
(demostrada por certificado con resultados
medidos para el baño)
-
Uniformidad: ± 0,2 mK @ 40 ºC (demostrada por
certificado con resultados medidos para el baño)
-
Resolución del Set Point: ≤ 0,01 ºC
-
Calentadores: 1000 W
-
Zona mínima de trabajo (Profundidad): 530 mm
-
Zona mínima de trabajo (diámetro): 100 mm
-
Volumen: > 7 L
-
Fuente de entrada (power supply) aproximada: 230
VAC (±10 %), 60 Hz, 9 A.
-
Sistema de conexión eléctrica compatible con las
normas nacionales.
-
Bloque igualador de bronce con cuatro agujeros de
8 mm de diámetro por 160 mm de profundidad
para colocar sensores de temperatura
2013.1
c4f_annexiitechspeciiitechoffer_es
Página 5 de 213
1.
2.
3.
4.
5.
Número
del
artículo
Especificaciones requeridas
Especificaciones ofrecidas
Notas, observaciones,
referencia a la
documentación
Notas del Comité
de Evaluación
-
-
-
-
-
Accesorios para aumentar el nivel del líquido
y la profundidad de calibración de termómetros
(incluso TLV de tallo largo)
Carrusel rotativo para montaje y protección de
aproximados 10 termómetros líquido en vidrio y
un termómetro patrón en el centro.
Equipo para mantener/fijar celdas de puntos
fijos
carrusel (mínimo 5 Termómetros
sistema monocular de aumento 8X
Garantía mínima: 1 año
Software e interfase baño-computadora para
controlar automáticamente el baño. La conexión a
PC debe realizarse por puerto USB (o RS232 con
adaptador USB preparado con controladores para
windows 7 y más reciente)
Incluye, líquido necesario para trabajar a
temperaturas entre -30 a 40 °C según volumen
necesario (dos veces el volumen a utilizar)
El equipo debe ser instalado y probado en
LANAMET por técnicos debidamente autorizados
por el fabricante. Los equipos de prueba son
suministrados por proveedor
2013.1
c4f_annexiitechspeciiitechoffer_es
Página 6 de 213
1.
2.
3.
4.
5.
Número
del
artículo
Especificaciones requeridas
Especificaciones ofrecidas
Notas, observaciones,
referencia a la
documentación
Notas del Comité
de Evaluación
TERMÓMETRO DE RESISTENCIA DE
PLATINO SECUNDARIO PT-100 DE
RESPUESTA RÁPIDA DE CUATRO HILOS CON
LECTOR DE REFERENCIA
Cantidad 1 (uno)
Características del Sistema
-
Calibrado por método de comparación (-38 a
350) °C.
Estuche rígido para transporte del lector y sonda
REQUISITOS GENERALES PARA
LOS CERTIFICADOS DE
CALIBRACIÓN:con trazabilidad a las
unidades básicas del SI
3
Rango nominal: –200 °C a 350 °C
RTPW Nominal: 100 Ω
Coeficiente de temperatura: 0.00385 Ω/Ω/°C
nominal
Exactitud
 calibrada @ 0 °C: ± 0.04 °C
 DIN/IEC Clase A @ 0 °C: ± 0.15 °C
Constante de tiempo de 0 °C a 100 °C: 3,0 s
Profundidad mínima de inmersión: 32 mm
Funda de la sonda: Acero inoxidable 316
longitud de la funda: (200 x 1,6) mm
-
Terminales de oro laminado en forma de U con
adaptadores necesarios para el lector de referencia
Calibrado en conjunto con el lector por método de
comparación (-38 a 350)°C
2013.1
c4f_annexiitechspeciiitechoffer_es
Página 7 de 213
1.
2.
3.
4.
5.
Número
del
artículo
Especificaciones requeridas
Especificaciones ofrecidas
Notas, observaciones,
referencia a la
documentación
Notas del Comité
de Evaluación
Con Lector de Referencia:
-
Canales de entrada: 2
Tipos de sensores: PRT, RTD, termistores y
termopares
Tipos de termopares: C, E, J, K, L, M, N, T,
U, B, R, S
Requisitos de alimentación eléctrica: baterías
recargables
Exactitud rango de milivolts: De –10 mV a 75
mV ± (0,005 % + 5 µV)
Exactitud rango de resistencia: De 0 Ω a 400 Ω: ±
(0,004 % + 0,002 Ω). De 200 Ω a 50 kΩ: ± (0,01 %
+ 0,5 Ω) y de 50 kΩ a 500 kΩ: ± (0,03 %)
4
DISPENSADOR DE LÍQUIDOS CON VÁLVULA
DISPENSADORA Y AGARRADERA
Cantidad: 1 (uno)
Características del Sistema
-
Capacidad de almacenamiento: >8 litros
Material: Polipropileno de alta densidad
5
MOLINO ELÉCTRICO PARA TRITURAR
HIELO
Cantidad: 1 (uno)
Características del Sistema
material: Acero inoxidable de alta pureza
capacidad de triturar hielo en forma frapé con granos
de diámetros menores a 5 mm
2013.1
c4f_annexiitechspeciiitechoffer_es
Página 8 de 213
1.
2.
3.
4.
5.
Número
del
artículo
Especificaciones requeridas
Especificaciones ofrecidas
Notas, observaciones,
referencia a la
documentación
Notas del Comité
de Evaluación
PURGA QUÍMICA Y ADITAMENTOS PARA
SONDA DE TEMPERATURA Y HUMEDAD (
para modelo hmp155, Marca Vaisala equipo ya en
existencia en el laboratorio )
Cantidad: 1 (uno)
Características del Sistema
Accesorios
6
-
Paquete de batería recargable para indicador
MI70
-
Set de protección para HMP155 (funda de
polímetro, o-ring, etc)
Set de calibración modelo HMK15 con Juego de sales
con certificado de calibración
-
Con 3 contenedores para prueba
-
Termómetro digital
-
Con bolso de transporte
2013.1
c4f_annexiitechspeciiitechoffer_es
Página 9 de 213
1.
2.
3.
4.
5.
Número
del
artículo
Especificaciones requeridas
Especificaciones ofrecidas
Notas, observaciones,
referencia a la
documentación
Notas del Comité
de Evaluación
LECTOR DIGITAL DE PARÁMETROS
AMBIENTALES (PRESIÓN BAROMÉTRICA,
HUMEDAD RELATIVA Y TEMPERATURA)
Cantidad: 4 (cuatro)
Características del Sistema
-
Sensores temperatura y humedad externos
Rango de Presión: 500 hPa a 1100 hPa
Exactitud: ± 0,1 hPa
Rango de Humedad Relativa: 0% RH a 100%
RH
-
Exactitud: ± 1% RH
Rango de temperatura: 0 ºC a 50 ºC
Exactitud: ± 0,1 ºC
Resolución: 0,1 hPa; 0,1 %RH; 0,01 °C
Longitud mínima de cable de sensores: 7 m
Pantalla LCD
Comunicación: USB
Fuente de poder (power supply): 110 – 220
VCA, 50-60 Hz con sistema de respaldo con batería
recargable con duración de al menos 4 h.
Sistema de conexión eléctrica compatible con
las normas nacionales
Vida útil de la batería: Al menos 4 años
Pantalla: LCD con visualización de gráficos
de tendencias en tiempo real
-
7
REQUISITOS GENERALES
PARA LOS CERTIFICADOS DE
CALIBRACIÓN:con trazabilidad a las
unidades básicas del SI
Garantía mínima: 1 año
Software para adquisición y gráfica de datos
(ambiente Windows 7 y XP)
Interface Lector-PC por conexión USB
-
2013.1
c4f_annexiitechspeciiitechoffer_es
Página 10 de 213
1.
2.
3.
4.
5.
Número
del
artículo
Especificaciones requeridas
Especificaciones ofrecidas
Notas, observaciones,
referencia a la
documentación
Notas del Comité
de Evaluación
-
Estuche rígido para transporte
Sistema de purga de líquidos para sensores
La calibración incluye, presión barométrica,
humedad relativa y temperatura, todas con sus
respectivas incertidumbres y calibrados por métodos
de comparación que cubran completamente el rango
total de medición de acuerdo a las especificaciones
técnicas solicitadas.
Los equipos deben ser instalados y probados
en LANAMET por técnicos debidamente autorizados
por el fabricante. Los equipos de prueba son
suministrados por proveedor.
Un (1) lector contará con dos (2) juegos de
sensores de Humedad Relativa y Temperatura
debidamente calibrados
(REQUISITOS GENERALES PARA LOS
CERTIFICADOS DE CALIBRACIÓN:incluido:
con trazabilidad a las unidades básicas del SI
2013.1
c4f_annexiitechspeciiitechoffer_es
Página 11 de 213
1.
2.
3.
4.
5.
Número
del
artículo
Especificaciones requeridas
Especificaciones ofrecidas
Notas, observaciones,
referencia a la
documentación
Notas del Comité
de Evaluación
SISTEMA DE OSMOSIS INVERSA Y DE AGUA
ULTRA PURA INTEGRADO PARA LA
PRODUCCIÓN DE AGUA TIPO I
Cantidad: 1 (uno)
Características del Sistema
Calidad del agua producto del Sistema de agua
ultra pura:
Resistividad (MΩ x cm): 18,2
COT (ppb) agua de alimentación con 100 ppb:
<1
-
8
COT (ppb) agua de alimentación con 1000
ppb: < 10
Unidades de absorbancia (AUFS a 210 nm):
< 0,005
Endotoxina (EU/ml): < 0,001
Partículas (0,2 μm): < 1/ml
Bacterias (CFU/1000 ml): < 1
Velocidad de flujo (l/min): hasta 1,5
Calidad del agua producto del Sistema de ósmosis
inversa
-
Porcentaje o velocidad de eliminación
Iones monovalentes: hasta un 98%
Iones polivalentes: hasta un 99%
Partículas: > 99%
Microorganismos: > 99%
Compuestos orgánicos disueltos (>300 MW):
> 99%
Flujo de eliminación [l/h]: 11-12
Velocidad de flujo del producto [l/h] (± 20% a
25°C): 15
Porcentaje máximo de recuperación: Aprox.
55%
1.
2.
3.
4.
5.
2013.1
c4f_annexiitechspeciiitechoffer_es
Página 12 de 213
1.
2.
3.
4.
5.
Número
del
artículo
Especificaciones requeridas
Especificaciones ofrecidas
Notas, observaciones,
referencia a la
documentación
Notas del Comité
de Evaluación
Requisitos del agua de alimentación de entrada:
-
Presión de entrada mínima: 1 bar
Presión de entrada máxima: 6,8 bar
TDS (máx ppm CaCO3): 360 o agua
desendurecida
Indice de densidad Silt: < 3%
Cloro libre: 0,1 ppm
Turbidez: < 1 NTU
Hierro (total como Fe): < 0,1 ppm
Características Fisicoquímicas:
Sólidos Suspendidos: (0 a 1000) mg / L
Conductividad (400 a 1000) ms/cm
Calcio (menor a 150) mg / L
Magnesio (menor a 50) mg/ L
Otros requisitos:
-
Torre de acero inoxidable
Sistema de osmosis inversa
Tanque de almacenamiento a presión,
capacidad mínima de 30 litros
Sistema de agua ultra pura incluyendo
lámpara UV y ultrafiltro
Analizador TOC
Set de cartuchos de pretratamiento
(tratamiento previo a la entrada al sistema) para el
sistema de osmosis inversa
Set de 2 x módulos RO
Set de cartuchos de agua ultra pura (1 x
cartucho de pretratamiento y 1 x cartucho de pulido)
Se debe proveer cartuchos de repuesto para
cumplir todos los requisitos tanto de entrada como de
salida del agua. Set de cartuchos de repuesto para
2013.1
c4f_annexiitechspeciiitechoffer_es
Página 13 de 213
1.
2.
3.
4.
5.
Número
del
artículo
Especificaciones requeridas
Especificaciones ofrecidas
Notas, observaciones,
referencia a la
documentación
Notas del Comité
de Evaluación
-
garantizar la producción de 1000 litros de agua
Producción de agua 15 litros por hora
El sistema debe ser instalado y probado en
LANAMET por técnicos debidamente autorizados
por el fabricante. Los equipos de prueba son
suministrados por proveedor
2013.1
c4f_annexiitechspeciiitechoffer_es
Página 14 de 213
1.
2.
3.
4.
5.
Número
del
artículo
Especificaciones requeridas
Especificaciones ofrecidas
Notas, observaciones,
referencia a la
documentación
Notas del Comité
de Evaluación
CALIBRADOR DE PRESIÓN PATRÓN DIGITAL
SENSORES CALIBRADOS EN 10 PUNTOS DE
TODO SU RANGO DE MEDICIÓN.
Cantidad: 1 (uno)
Características del Sistema
Rango de trabajo:
Desde Vacuómetro a 10 Mpa
1500 psi)
(aprox: -15 psi a
Exactitud:
9
- Presión: ±0,008% de la lectura
-Conexiones de entrada de presión negativa y positiva.
- Generador / controlador de presión desde vacio hasta
20 Mpa, con variación de volumen de regulación por
cada rotación de 0,7 cm3 (0.04 cu.in.)
- RS232 (COM1, COM2) y USB
Rangos:
- 10 MPa (1 500 Psi) presión absoluta y relativa.
- 7 MPa (1 000 Psi) presión absoluta y relativa
- 2 MPa ( 300 Psi) presión absoluta y relativa
- 700 kPa (100 Psi) presión absoluta y relativa.
- 300 kPa (45 Psi) presión absoluta / 200 kPa (30 Psi)
presión relativa.
Resolución: 0,001 %
- Medio compatible: líquidos o gases compatibles con
acero inoxidable
2013.1
c4f_annexiitechspeciiitechoffer_es
Página 15 de 213
1.
2.
3.
4.
5.
Número
del
artículo
Especificaciones requeridas
Especificaciones ofrecidas
Notas, observaciones,
referencia a la
documentación
Notas del Comité
de Evaluación
Accesorios incluidos:
-
Software e interfase
Estuche metálico para transporte
Manuales de operación para equipo y software
Cable USB de 2 m. protegido
Cable de coneccion de potencia (7,5 pie).
Con Accesorios para la conexión de
Manómetros (tuberías, te, codo, válvulas.). para alta
presión de acero inoxidble y para baja presión en
mangueras de plástico.
REQUISITOS GENERALES PARA
LOS CERTIFICADOS DE
CALIBRACIÓN:incluido:
con trazabilidad a las unidades básicas del SI
2013.1
c4f_annexiitechspeciiitechoffer_es
Página 16 de 213
1.
2.
3.
4.
5.
Número
del
artículo
Especificaciones requeridas
Especificaciones ofrecidas
Notas, observaciones,
referencia a la
documentación
Notas del Comité
de Evaluación
BARÓMETRO PATRÓN DE REFERENCIA (70
A 110) kPa.
Cantidad: 1 (uno)
Características del Sistema
Barómetro patrón de referencia (calibrado).
Alcance (70 a 110) kPa
Puerto de comunicación: RS232 (COM1, COM2)
Conector a puerto de prueba 1/8” NPT F
Exactitud: 0,008 % de la lectura.
Resolución 1 ppm
10
- Medio compatible: gas
Accesorios incluidos:
-
Estuche metálico para transporte
Manuales de operación para equipo
Cable USB de 2 m. protegido
Con Accesorios para la conexión a generador/
controlador de presión. (tuberías, te, codo, válvulas.).
REQUISITOS GENERALES PARA LOS
CERTIFICADOS DE CALIBRACIÓN:incluido:
con trazabilidad a las unidades básicas del SI
CALIBRADOR DE PRESIÓN PATRÓN DIGITAL
(CON BOMBA MANUAL)
11
Cantidad: 1 (uno)
Características del Sistema
Rango de trabajo:
Desde Vacuómetro a 10 mPa
2013.1
c4f_annexiitechspeciiitechoffer_es
(aprox: -15 psi a
Página 17 de 213
1.
2.
3.
4.
5.
Número
del
artículo
Especificaciones requeridas
Especificaciones ofrecidas
Notas, observaciones,
referencia a la
documentación
Notas del Comité
de Evaluación
1500 psi)
Bomba manual incluida.
Transductores en tres rangos de medición
-
Exactitud: ±0,01% de ET
Modo de operación en presión relativa.
Medio de generación de presión neumática.
REQUISITOS GENERALES PARA LOS
CERTIFICADOS DE CALIBRACIÓN:con
trazabilidad a las unidades básicas del SI
-
Estuche metálico para transporte
Manuales de operación para equipo.
Juego de conectores.
Soporte para manómetro de prueba.
Garantía mín: 1 año
12
MEDIDOR DE ALTURA, TIPO ESTÁNDAR
Cantidad: 1 (uno)
Características del Sistema
- Rango de medición: (0 a 600) mm
- Resolución: 0,01 mm
Temperatura de operación de 0 ºC a 40 ºC
REQUISITOS GENERALES PARA LOS
CERTIFICADOS DE CALIBRACIÓN:con
trazabilidad a las unidades básicas del SI
13
MIRA TELESCÓPICA CON PEDESTAL
MÓVIL PARA CALIBRACIÓN DE
MANÓMETROS ANALÓGICOS
Cantidad: 1 (uno)
2013.1
c4f_annexiitechspeciiitechoffer_es
Página 18 de 213
1.
2.
3.
4.
5.
Número
del
artículo
Especificaciones requeridas
Especificaciones ofrecidas
Notas, observaciones,
referencia a la
documentación
Notas del Comité
de Evaluación
Características del Sistema
- Lente de aumento: 8 X, Distancia de foco: 1,7 m
Soporte ajustable (móvil)
accesorios para movimiento horizontal y vertical.
Altura: (70 a 150) cm
2013.1
c4f_annexiitechspeciiitechoffer_es
Página 19 de 213
1.
2.
3.
4.
5.
Número
del
artículo
Especificaciones requeridas
Especificaciones ofrecidas
Notas, observaciones,
referencia a la
documentación
Notas del Comité
de Evaluación
BALANZA COMPARADOR DE MASA HASTA
1 kg CON DISPOSITIVO DE PESADA BAJO
LA BALANZA
Cantidad: 1 (uno)
Características del Sistema
14
-
-
-
-
Capacidad máxima: 1110 g
Características del Sistema
Capacidad máxima: 1110 g
División de escala: 0,01 mg
Repetibilidad: 0,03 mg
Tiempo de estabilización (típico): 10…20 s
Desviación por excentricidad: 15 µg/mm
Permite ajuste interno y externo
Protector contra corrientes de aire motorizado
Incluye pesa para ajuste externo E2-OIML con
certificado de calibración (valor nominal de
acuerdo a requerimiento del comparador)
Software adicional con licencia para adquisición de
datos en tiempo real por medio de PC. Interface
Lector-PC por conexión USB. Trabajo en ambiente
Windows 7 permite descarga de datos hoja cálculo
Excel
REQUISITOS GENERALES PARA LOS
CERTIFICADOS DE CALIBRACIÓN: para la (s)
pesas con trazabilidad a las unidades básicas del SI
Equipo instalado y probado en LANAMET por
técnicos autorizados por el fabricante. Equipos de
prueba son suministrados por proveedor.
2013.1
c4f_annexiitechspeciiitechoffer_es
Página 20 de 213
1.
2.
3.
4.
5.
Número
del
artículo
Especificaciones requeridas
Especificaciones ofrecidas
Notas, observaciones,
referencia a la
documentación
Notas del Comité
de Evaluación
GRÚA MURAL PIVOTANTE
Cantidad: 2 (dos)
Características del Sistema
-
15
Datos de rendimiento de la grúa pivotante:
construidas y equipada según DIN 15018
clase de elevación H2
grupo de esfuerzo B3 para uso en áreas de
producción.
Capacidad de carga: 160 kg
Alcance de la pluma: 2000 mm
Alcance de giro: 270 grados
Peso de la pluma: 40 kg
Peso de la consola: 45 kg
Peso total incl. Mecanismo elevador, aprox:
113 kg
Datos de rendimiento del mecanismo
elevador:
Capacidad de carga: 160 kg
Paso entrando/tramos de cadena: 1/1
Grupo FEM: 4 m
Longitud de cable de mando: 800- 3800 mm
Recorrido de gancho: 5000 mm
Velocidad de elevación
1. V mín: 0,15 m/min
2. V nominal: 16,00 m/min
3. V máx: 30,00 m/min
Potencia de motor: 0,25/0,06 kW
Peso del mecanismo elevador: 16 kg
Peso de combinador y línea de mando: 2 kg
Clase de protección: IP55
Tipo de mando: mando directo
Auxilios de elevación para grúa mural pivotante
adecuados para pesas de bloque, con asa, de 20 kg y 50
kg
2013.1
c4f_annexiitechspeciiitechoffer_es
Página 21 de 213
1.
2.
3.
4.
5.
Número
del
artículo
Especificaciones requeridas
Especificaciones ofrecidas
Notas, observaciones,
referencia a la
documentación
Notas del Comité
de Evaluación
-
polipasto eléctrico de cadena tipo DKUN 1125 K V1 1/1 F4
equipado con motor con inducido deslizante y
freno cónico regulable y asegurado por un
acoplamiento de resbalamiento contra el sobrepaso de
las posiciones de gancho superior e inferior.
Cadena especial redonda resistente al envejecimiento e
insensible contra golpe y esfuerzo de flexión
La grúa mural pivotante consta de:
1.
Consola
2.
Pluma con dispositivo de avance
3.
cubierta Terminal
4.
Patines guías y tope
5.
Accesorio eléctrico con interruptor de
conexión a la red y 6 m cable plano y piezas
pequeñas
6.
2 rótulos capacidad de carga, 1 de la fábrica e
instrucciones de funcionamiento
7.
Polipasto de cadena DCS-Pro 2-160 1/1
Accesorios para ayuda de elevación y Columna de
apoyo
Incluye montaje empotrado a muro (según sitio
detallado por LANAMET), conexiones eléctricas e
instrucción de uso por personal técnico calificado
y capacitación para uso a personal de LANAMET
2013.1
c4f_annexiitechspeciiitechoffer_es
Página 22 de 213
1.
2.
3.
4.
5.
Número
del
artículo
Especificaciones requeridas
Especificaciones ofrecidas
Notas, observaciones,
referencia a la
documentación
Notas del Comité
de Evaluación
PATRÓN DE MASA DE 50 kg
Cantidad: 2 (dos)
Características del Sistema
-
16
clase de exactitud F1 (OIML)
material: acero inoxidable altamente pulido
con acabado superficial a espejo
Forma cilíndrica con agarradero (gancho) sin
cavidad de ajuste (monobloque)
Estuche rígido resistente adecuado para
almacenamiento, transporte y resguardo del patrón.
Accesorios para manipulación de la pesa con grúa
pivotante
-
REQUISITOS GENERALES
PARA LOS CERTIFICADOS DE
CALIBRACIÓN: con trazabilidad a las
unidades básicas del SI. Incluye, masa convencional,
densidad o volumen todos con sus respectivas
incertidumbres
Cumple con todos los requisitos de la
Recomendación OIML R111
2013.1
c4f_annexiitechspeciiitechoffer_es
Página 23 de 213
1.
2.
3.
4.
5.
Número
del
artículo
Especificaciones requeridas
Especificaciones ofrecidas
Notas, observaciones,
referencia a la
documentación
Notas del Comité
de Evaluación
PATRÓN DE MASA DE 20 kg
Cantidad: 2 (dos)
Características del Sistema
-
17
clase de exactitud E2 (OIML)
material: acero inoxidable altamente pulido
con acabado superficial a espejo
Forma cilíndrica de botón sin cavidad de
ajuste (monobloque)
Estuche rígido resistente adecuado para
almacenamiento, transporte y resguardo.
-
REQUISITOS GENERALES
PARA LOS CERTIFICADOS DE
CALIBRACIÓN:con trazabilidad a las
unidades básicas del SI. Incluye, masa convencional,
densidad o volumen todos con sus respectivas
incertidumbres
Cumple con todos los requisitos de la
Recomendación OIML R111.
2013.1
c4f_annexiitechspeciiitechoffer_es
Página 24 de 213
1.
2.
3.
4.
5.
Número
del
artículo
Especificaciones requeridas
Especificaciones ofrecidas
Notas, observaciones,
referencia a la
documentación
Notas del Comité
de Evaluación
JUEGO DE MASAS DE 1 g A 5 kg.
Cantidad: 2 (dos)
Características del Sistema
18
-
clase de exactitud M1
material: acero inoxidable finamente pulido
Forma: cilíndrica de botón sin cavidad de
ajuste (monobloque).
Estuche rígido resistente adecuado para
almacenamiento, transporte y resguardo para el juego
de masa.
No se requiere certificado de calibración
2013.1
c4f_annexiitechspeciiitechoffer_es
Página 25 de 213
1.
2.
3.
4.
5.
Número
del
artículo
Especificaciones requeridas
Especificaciones ofrecidas
Notas, observaciones,
referencia a la
documentación
Notas del Comité
de Evaluación
JUEGO DE ACCESORIOS PARA
MANIPULACIÓN DE MASA
Cantidad: 1 (uno)
Características del Sistema
-
19
veinte (20) pares de guantes sintético de
microfibra, nylon, diseñados para manipulación de
pesas
cinco (5) pinzas metálicas de extremos rectos
con punta de carbono o cubierta de silicón para pesas
de 1 mg a 20 g, longitud: 115 mm
cinco (5) pinzas metálicas de extremo
curvados con punta de carbono o cubierta de silicón
para pesas de 20 g a 200 g, longitud: 200 mm
una horquilla de aluminio y extremo de
Polyamida o material sintético especial para
manipular patrones de masa, para las pesas de 500 g,
longitud: 300 mm
una horquilla de aluminio y extremo de
Polyamida o material sintético especial para
manipular patrones de masa, para las pesas de 1 kg,
longitud: 300 mm
una horquilla de aluminio y extremo de
Polyamida o material sintético especial para
manipular patrones de masa, para las pesas de 2 kg,
longitud: 300 mm
Dos (2) mancuernas aceradas para pesa de 50
kg
Tres (3) mancuernas aceradas para pesa de 20
kg
Dos (2) tenazas universales con insertos de
silicón para manipulación de pesas hasta 2 kg
2013.1
c4f_annexiitechspeciiitechoffer_es
Página 26 de 213
1.
2.
3.
4.
5.
Número
del
artículo
Especificaciones requeridas
Especificaciones ofrecidas
Notas, observaciones,
referencia a la
documentación
Notas del Comité
de Evaluación
EQUIPO DE CALIBRACIÓN PARA LA SONDA
DE HUMEDAD MONITOREADO Y
CONTROLADO POR HIGRÓMETRO
PRIMARIO CON TECNOLOGÍA DE ESPEJO
FRÍO Y SENSOR DE TEMPERATURA RTD
Cantidad: 1 (uno)
Características del Sistema
20
-
Exactitud Dew Point: ± 0.2°C dew/frost point
Repetibilidad Dew Point: 0.1°C
Exactitud de Temperatura: ±0.15°C
Repetibilidad de temperature: 0.05°C
Resolución: 0,01 ºC
Permite auto balanceo y limpieza
Data logger
Rango de operación para humedad: 0 a 95%
RH sin condensar
Espejo de platino sólido
Barrera de vapor de acero inoxidable
Termómetro: TRP de 4 hilos
-
REQUISITOS GENERALES
PARA LOS CERTIFICADOS DE
CALIBRACIÓN:con trazabilidad a las
unidades básicas del SI que cubran completamente el
rango total de medición de acuerdo a las
especificaciones técnicas solicitadas
Garantía mínima: 1 año
Software para adquisición y gráfica de datos
(ambiente Windows 7 y XP)
Interface higrómetro-PC por conexión USB
Estuche rígido para transporte
2013.1
c4f_annexiitechspeciiitechoffer_es
Página 27 de 213
1.
2.
3.
4.
5.
Número
del
artículo
Especificaciones requeridas
Especificaciones ofrecidas
Notas, observaciones,
referencia a la
documentación
Notas del Comité
de Evaluación
Los equipos deben ser instalados y probados en
LANAMET por técnicos debidamente autorizados
por el fabricante. Los equipos de prueba son
suministrados por proveedor
2013.1
c4f_annexiitechspeciiitechoffer_es
Página 28 de 213
1.
2.
3.
4.
5.
Número
del
artículo
Especificaciones requeridas
Especificaciones ofrecidas
Notas, observaciones,
referencia a la
documentación
Notas del Comité
de Evaluación
JUEGO DE MASA DE 1 mg A 1 kg. Clase E2
Cantidad: 2 (dos)
Características del Sistema
-
21
clase de exactitud E2 (OIML)
material: acero inoxidable altamente pulido
con acabado superficial a espejo.
Forma:
1 mg a 500 mg: alambre marcada
1 g a 1 kg: cilíndrica de botón sin cavidad de
ajuste (monobloque).
Pesa de igual valor nominal deben ser
marcada
Sensibilidad magnética < 0,01
Estuche rígido resistente adecuado para
almacenamiento, transporte y resguardo para el juego
de masa.
Accesorios para manipulación:
5 pares de guantes de material sintético de
microfibra, nylon, diseñados para manipulación de
pesas
2 pinzas metálicas de extremos rectos con
punta de carbono o cubierta de silicón para pesas de 1
mg a 20 g, longitud: 115 mm
2 pinzas metálicas de extremos rectos con
punta de carbono o cubierta de silicón para pesas de 1
mg a 20 g, longitud: 220 mm
2 pinzas metálicas de extremo curvados con
punta de carbono o cubierta de silicón para pesas de
20 g a 200 g, longitud: 200 mm
2 horquillas de aluminio y extremo de
Polyamida o material sintético especial para
manipular patrones de masa, para las pesas de 500 g –
1 kg, longitud: 300 mm, 2 brochas de cerdas suave
para pesas de 1 mg a 5 g
2013.1
c4f_annexiitechspeciiitechoffer_es
Página 29 de 213
1.
2.
3.
4.
5.
Número
del
artículo
Especificaciones requeridas
Especificaciones ofrecidas
Notas, observaciones,
referencia a la
documentación
Notas del Comité
de Evaluación
2 brochas de cerdas suave para pesas de 10 g a 1 kg
-
REQUISITOS GENERALES
PARA LOS CERTIFICADOS DE
CALIBRACIÓN:con trazabilidad a las
unidades básicas del SI. Incluye, masa convencional,
densidad o volumen todos con sus respectivas
incertidumbres
Cumple con todos los requisitos de la
Recomendación OIML R111
22
CALIBRADOR MAESTRO PARA
MICRÓMETROS DE INTERIORES
Cantidad: 1 (uno)
Características del Sistema
-
El material de Cerámica de Zirconio.
Capacidad hasta 300 mm.
Longitudes a inspeccionar: (25, 50, 75, 100, 125,
150, 175, 200, 225, 250, 275, 300) mm
- Desviación: ±(0,001 + L/150000) mm*
* L = Longitud a inspeccionar (mm).
Accesorio:
-
Estuche rígido resistente adecuado para
almacenamiento, transporte y resguardo del patrón.
REQUISITOS GENERALES PARA
LOS CERTIFICADOS DE
CALIBRACIÓN:con trazabilidad a las unidades
básicas del SI
2013.1
c4f_annexiitechspeciiitechoffer_es
Página 30 de 213
1.
2.
3.
4.
5.
Número
del
artículo
Especificaciones requeridas
Especificaciones ofrecidas
Notas, observaciones,
referencia a la
documentación
Notas del Comité
de Evaluación
CALIBRADOR MAESTRO DE ALTURAS
(CON BLOQUES ESCALONADOS)
Cantidad: 1 (uno)
Características del Sistema
23
-
Intervalo de medición: 10 < R ≤ 600 mm
Resolución: 0,001 mm
Paso del bloque : 20 mm
Error paso del Bloque: ± 0,0015 mm
Paralelismo de los bloques: 0,004 mm
Que pueda ser usado con bloques adicionales
Con bloque patrón para fijar cero
Graduaciones (20; 50; 100; 150; 200; 300; 400;
500; 550 y 600)mm
REQUISITOS GENERALES PARA
LOS CERTIFICADOS DE
CALIBRACIÓN:con trazabilidad a las unidades
básicas del SI (Aplican requisitos detallados en II. de
éste documento)
2013.1
c4f_annexiitechspeciiitechoffer_es
Página 31 de 213
1.
2.
3.
4.
5.
Número
del
artículo
Especificaciones requeridas
Especificaciones ofrecidas
Notas, observaciones,
referencia a la
documentación
Notas del Comité
de Evaluación
JUEGO DE BLOQUES.
Cantidad: 1 (uno)
Características del Sistema
-
24
Grado: 0
Contenido 47 piezas
Medidas: (1,005;1,01-1,19;1,2 -1,9 ;1 - 9;10 -100)
mm
- Intervalo :( - ; 0,01 ; 0,1 ; 1 ; 10)
mm
- Estuche rígido resistente adecuado para
almacenamiento, transporte y resguardo para el juego
de bloques.
- Estuche de mantenimiento
-
-
REQUISITOS GENERALES
PARA LOS CERTIFICADOS DE
CALIBRACIÓN: con trazabilidad a las
unidades básicas del SI
Material: Acero Inoxidable
MESAS DE GRANITOS
Cantidad: 2 (dos)
Características del Sistema
25
-
Medidas ( alto x ancho x largo)
(750 x 600 x 900 )mm grosor 80 mm
Mesa especializada para mediciones de equipos de
longitud
2013.1
c4f_annexiitechspeciiitechoffer_es
Página 32 de 213
1.
2.
3.
4.
5.
Número
del
artículo
Especificaciones requeridas
Especificaciones ofrecidas
Notas, observaciones,
referencia a la
documentación
Notas del Comité
de Evaluación
JUEGO DE BLOQUES PARA CALIBRACIÓN
DE MICRÓMETROS. Grado 1
Cantidad: 1 (uno)
Características del Sistema
-
26
Grado: 1
Contenido 10 piezas
Medidas: (2,5;5,1;7,7;10,3;12,9;15;17,6;20,2;22,8;
25)mm
- Estuche rígido resistente adecuado para
almacenamiento, transporte y resguardo para el juego
de bloques.
- Estuche de mantenimiento
- Soporte de bloques (cala)
-
-
REQUISITOS GENERALES
PARA LOS CERTIFICADOS DE
CALIBRACIÓN:con trazabilidad a las
unidades básicas del SI
Material: Acero Inoxidable
ESTUCHE DE MANTENIMIENTO
Cantidad: 1 (uno)
Características del Sistema
27
-
Para juego de bloques (Aceite antioxidante en
spray, Ceraston (100x25x12)mm, galga de vidrio Ø
45x12 mm, pinceles, pulverizador de aire, papel
especial para limpieza, Gamuza, frasco cuenta gota,
guantes
2013.1
c4f_annexiitechspeciiitechoffer_es
Página 33 de 213
1.
2.
3.
4.
5.
Número
del
artículo
Especificaciones requeridas
Especificaciones ofrecidas
Notas, observaciones,
referencia a la
documentación
Notas del Comité
de Evaluación
MICRÓMETRO CALIBRADOR DE ALTURAS
Cantidad: 1 (uno)
Características del Sistema
28
-
Intervalo: 600 mm
Lectura: 0,001 mm
División de escala: 0.002 mm ; Distancia entre
bloques: 20 mm
REQUISITOS GENERALES PARA
LOS CERTIFICADOS DE
CALIBRACIÓN:con trazabilidad a las
unidades básicas del SI
JUEGO DE BLOQUES RECTANGULARES
MÉTRICO
Cantidad: 1 (uno)
Características del Sistema
29
-
grado 0
medidas (0,1; 0,2; 0,3; 0,4; 0,5; 0,6; 0,7; 0,8;
0,95) mm
-
REQUISITOS GENERALES
PARA LOS CERTIFICADOS DE
CALIBRACIÓN:con trazabilidad a las
-
unidades básicas del SI
Material: Acero Inoxidable
2013.1
c4f_annexiitechspeciiitechoffer_es
Página 34 de 213
1.
2.
3.
4.
5.
Número
del
artículo
Especificaciones requeridas
Especificaciones ofrecidas
Notas, observaciones,
referencia a la
documentación
Notas del Comité
de Evaluación
COMPARADOR DE BLOQUES PATRÓN
Cantidad: 1 (uno)
Características del Sistema
30
-
Intervalo de medición: = 0,1 mm a 300 mm
Con doble palpador y accesorios
Resolución: 0,00001 mm
Exactitud intervalo cerrado: ±
(0.03+0.3L/1|000)µm
-
REQUISITOS GENERALES
PARA LOS CERTIFICADOS DE
CALIBRACIÓN:con trazabilidad a las
unidades básicas del SI
PATRONES PARA LA CALIBRACIÓN DE
EQUIPOS DE ENSAYOS A TENSIÓN
Cantidad: 1 (uno)
Características del Sistema
-
31
Juego de celdas de (5, 10, 50, 100, 200, 600) kN a
tracción de la clase 05 (ISO 376). Con accesorios
para la instalación en las máquinas de ensayo.
- Puente indicador con cable incluido (7 m)
- sofware para transferencia de datos, accesorios
(medidor de nivel, medidor de dureza, y galgas para
centrar las celdas en los platos de la máquina de
ensayo).
- Maleta para transportación (con ruedas)
-
REQUISITOS GENERALES
PARA LOS CERTIFICADOS DE
CALIBRACIÓN:de cada una de las celdas y el
puente con trazabilidad a las unidades básicas del SI
2013.1
c4f_annexiitechspeciiitechoffer_es
Página 35 de 213
1.
2.
3.
4.
5.
Número
del
artículo
Especificaciones requeridas
Especificaciones ofrecidas
Notas, observaciones,
referencia a la
documentación
Notas del Comité
de Evaluación
PATRON PARA LA CALIBRACIÓN DE
EQUIPOS DE ENSAYOS A COMPRESIÓN
Cantidad: 1 (uno)
Características del Sistema
-
32
Juego de celdas de (5, 10, 50, 100, 200, 600) kN a
compresión y otra de 1MN a compresión de la clase
05 (ISO 376). ). Con accesorios para la instalación en
las máquinas de ensayo.
- Puente indicador con cable incluido (7 m)
- sofware para transferencia de datos, accesorios
(medidor de nivel, medidor de dureza, y galgas para
centrar las celdas en los platos de la máquina de
ensayo). Maleta para transportación
-
REQUISITOS GENERALES
PARA LOS CERTIFICADOS DE
CALIBRACIÓN:de cada una de las celdas y el
puente con trazabilidad a las unidades básicas del SI
2013.1
c4f_annexiitechspeciiitechoffer_es
Página 36 de 213
1.
2.
3.
4.
5.
Número
del
artículo
Especificaciones requeridas
Especificaciones ofrecidas
Notas, observaciones,
referencia a la
documentación
Notas del Comité
de Evaluación
PATRÓN VOLUMÉTRICO DE ACERO
INOXIDABLE 20 Litros (con estuche)
Cantidad: 1 (uno)
Características del Sistema
-
33
Intervalo de medición: 20 Litros
Exactitud : 1 ml
Pozo para sensor de temperatura.
Incluir un termómetro de resistencia de platino PT
100 de cuatro hilos y funda de acero inoxidable con
su indicador para lecturas de resistencia eléctrica, y
temperatura por medio de ITS 90 con cable de
extensión de 3 metros como mínimo
Con especificación del coeficiente de expansión
térmica en °C-1
-
REQUISITOS GENERALES
PARA LOS CERTIFICADOS DE
CALIBRACIÓN:con trazabilidad a las
unidades básicas del SI
2013.1
c4f_annexiitechspeciiitechoffer_es
Página 37 de 213
1.
2.
3.
4.
5.
Número
del
artículo
Especificaciones requeridas
Especificaciones ofrecidas
Notas, observaciones,
referencia a la
documentación
Notas del Comité
de Evaluación
PATRÓN VOLUMÉTRICO DE ACERO
INOXIDABLE 19 litros (con estuche)
Cantidad: 1 (uno)
Características del Sistema
34
- Intervalo de medición: 19 Litros
- Resolución: 5 ml
Con especificación del coeficiente de expansión
térmica en °C-1
- SIN CALIBRAR
2013.1
c4f_annexiitechspeciiitechoffer_es
Página 38 de 213
1.
2.
3.
4.
5.
Número
del
artículo
Especificaciones requeridas
Especificaciones ofrecidas
Notas, observaciones,
referencia a la
documentación
Notas del Comité
de Evaluación
PATRÓN VOLUMÉTRICO DE ACERO
INOXIDABLE 50 Litros (con estuche)
Cantidad: 1 (uno)
Características del Sistema
35
-Intervalo de medición: 50 Litros
-Escala de ± 300 ml
Tubo capilar de vidrio
-Terminado en pulido brillante el exterior y el interior
-Embalaje en caja metálica
-Tapa de acero Inoxidable
-Resolución: 10 ml
-Con especificación del coeficiente de expansión
térmica en °C-1
-Construido con las recomendaciones del NIST
(Handbook 105-3 Standards) y R-120 de la OIML
-Manufacturado con Acero inoxidable serie 300
- El cuerpo cilíndrico del cuello tendrá incrustado un
cilindro de vidrio (de borosilicato) y una placa para la
escala graduada, de aluminio.
-Salida para drenar el líquido con válvula de cierre.
- Ajuste del cero en la parte inferior.
- Sensor de temperatura de acuerdo a la norma R-120
de OIML
- Salida para escurrir liquido excedente
- Tres patas de soporte con niveles ajustables
-Nivel de burbuja u otro tipo para nivelar equipo
-REQUISITOS GENERALES PARA LOS
CERTIFICADOS DE CALIBRACIÓN:con
trazabilidad a las unidades del SI. El certificado de
calibración debe cumplir con todos los requisitos de la
norma ISO/IEC 17025. El laboratorio que lo emite
debe ser un Laboratorio Nacional de Metrología o un
laboratorio secundario debidamente acreditado
2013.1
c4f_annexiitechspeciiitechoffer_es
Página 39 de 213
1.
2.
3.
4.
5.
Número
del
artículo
Especificaciones requeridas
Especificaciones ofrecidas
Notas, observaciones,
referencia a la
documentación
Notas del Comité
de Evaluación
PATRÓN VOLUMÉTRICO DE ACERO
INOXIDABLE 200 litros (con estuche)
Cantidad: 1 (uno)
Características del Sistema
36
Valor Nominal: 200 Litros
Con especificación del coeficiente de expansión
térmica en °C-1
División mínima de 50 ml
Escala de ± 500 ml
Tubo capilar de vidrio
Terminado en pulido brillante en el interior
Tapa de acero Inoxidable.
Construido con las recomendaciones del NIST
(Handbook 105-3 Standards) y R-120 de la OIML
-Manufacturado con Acero inoxidable serie 300
- El cuerpo cilíndrico del cuello tendrá incrustado un
cilindro de vidrio (de borosilicato) y una placa para la
escala graduada, de aluminio.
-Salida para drenar el liquido contenido con válvula de
cierre
- Salida para escurrir liquido excedente.
-Ajuste del cero en la parte inferior
- Sensor de temperatura de acuerdo a la norma R-120
de OIML
- Patas de soporte con niveles ajustables
-Nivel de burbuja u otro tipo de nivel para nivelar el
equipo.
-Remolque especial para traslado y para trabajar en
campo con el patrón (Superficie del remolque de acero
inoxidable)
2013.1
c4f_annexiitechspeciiitechoffer_es
Página 40 de 213
1.
2.
3.
4.
5.
Número
del
artículo
Especificaciones requeridas
Especificaciones ofrecidas
Notas, observaciones,
referencia a la
documentación
Notas del Comité
de Evaluación
LOTE 2 – MATERIALES PARA INSPECCIÓN FITO-SANITARIA
1
Guantes de látex
Cantidad: 30,000 (treinta mil)


2
cajas de paquetes de 100 pares,
talla "L" ,
Guantes de látex
Cantidad: 10,000 (diez mil)


3
cajas de paquetes de 100 pares,
talla "M" ,
Lentes protectores
Cantidad: 310 (trescientos diez)
Resistencia al impacto de partículas a alta velocidad y
baja energía a temperatutas extremas.
Protección frente a radiación UV (99.9%)
Alta calida óptima, clase óptica 1
Tratamiento anti-rayadura. Policarbonato.
Longitud de la patilla ajustable(4 posiciones)
Extremo de las patillas blando y flexible para reducir la
presión
 Ocular gris
2013.1
c4f_annexiitechspeciiitechoffer_es
Página 41 de 213
1.
2.
3.
4.
5.
Número
del
artículo
Especificaciones requeridas
Especificaciones ofrecidas
Notas, observaciones,
referencia a la
documentación
Notas del Comité
de Evaluación
4
Bolsas de cierre plásticas Resellables o abre fácil
Cantidad: 95,000 (noventa y cinco mil)
5
1.
1.27 cm ancho x 27,6 cm largo (20,000
unidades)
2.
2.18 cm ancho x 20 cm de largo (10, 000
unidades)
3.
3.15,2 cm ancho x 22,9 cm de largo (50,000
unidades)
4.
4.10 cm ancho x 15,5 cm de largo (15,000)
Tabla sujeta papeles
Cantidad: 315 (trescientos quince)

6
Tablas plásticas para sostener papel tamaño
carta
Cuchillos
Cantidad: 260 (doscientos sesenta)



7
7 pulgada
acero inoxidable ,
mango aluminio
Máscaras quirúrgicas
Cantidad: 5,000 (cinco mil)
 Rectangulares,
 cajas o paquetes de 50 unidades
2013.1
c4f_annexiitechspeciiitechoffer_es
Página 42 de 213
1.
2.
3.
4.
5.
Número
del
artículo
Especificaciones requeridas
Especificaciones ofrecidas
Notas, observaciones,
referencia a la
documentación
Notas del Comité
de Evaluación
8
Thermo para muestra
Cantidad: 36 (treinta y seis)


9
para muestra 9 QT(8.55 L )
material externo de polietileno con aislante
poliuretano
Thermo Rodante para muestra
Cantidad: 36 (treinta y seis)


10
Rodante para muestra 40 QT(38 L)
material externo de polietileno con aislante
poliuretano
Gorros
Gorros: 5,000 (cinco mil)



11
Red para cabello
desechables
cajas de paquete de 100
Gabachas Unisex
Cantidad: 100 (cien)
 tela blanca
 manga corta
 talla " XL"
2013.1
c4f_annexiitechspeciiitechoffer_es
Página 43 de 213
1.
2.
3.
4.
5.
Número
del
artículo
Especificaciones requeridas
Especificaciones ofrecidas
Notas, observaciones,
referencia a la
documentación
Notas del Comité
de Evaluación
12
Gabachas Unisex
Cantidad: 100 (cien)



13
tela blanca
manga corta con dos bolsas en la parte de
abajo
talla " L"
Gabachas Unisex
Cantidad: 100 (cien)



14
tela blanca
manga corta
talla " M"
Gabachas Unisex
Cantidad: 100 (cien)



15
tela blanca
manga corta
talla " S"
Espátula
Cantidad: 260 (doscientos sesenta)


acero inoxidable
Tamaño 16.5cm
2013.1
c4f_annexiitechspeciiitechoffer_es
Página 44 de 213
1.
2.
3.
4.
5.
Número
del
artículo
Especificaciones requeridas
Especificaciones ofrecidas
Notas, observaciones,
referencia a la
documentación
Notas del Comité
de Evaluación
16
Kit Comparador de cloro libre y total
Cantidad: 40 (cuarenta)


17
Rango ( 0 -5 ppm )
Con cinta de Ph (0-14)
Maletín tipo bolso
Cantidad: 100 (cien)


18
Tamaño 17 *14 pulgadas aproximado
De nylon resistente en el exterior.
Compartimentos interiores y exteriores para
mejor organización. Seguridad con
compartimento acolchado interior. Correa
acolchada para hombro.
Lupa con pinzas
Cantidad: 260 (doscientos sesenta)

compacta de 4.5
2013.1
c4f_annexiitechspeciiitechoffer_es
Página 45 de 213
1.
2.
3.
4.
5.
Número
del
artículo
Especificaciones requeridas
Especificaciones ofrecidas
Notas, observaciones,
referencia a la
documentación
Notas del Comité
de Evaluación
19
Foco/Linterna
Cantidad: 260 (doscientos sesenta)




20
Material plástico
Sistema de alimentación: Baterías (2) de 1.2
V
Luz de led
Sistema óptico
Lamotte * Iodine Test Kit Dropper Pipet, Test;
Cantidad: 30 (treinta)
Cada kit viene en una caja plastica que contiene:
 Reactivo Iodine # 1 (15 ml)



21
Reactivo Iodine # 2 (15 ml)
Reactivo Iodine # 3 (60 ml)
Tubo plástico de 5-10-25 ml
Pipeta plástica con gotero
Capotes de dos piezas para adultos
Cantidad: 260 (doscientos sesenta)


Talla única
Material de nitrilo
2013.1
c4f_annexiitechspeciiitechoffer_es
Página 46 de 213
1.
2.
3.
4.
5.
Número
del
artículo
Especificaciones requeridas
Especificaciones ofrecidas
Notas, observaciones,
referencia a la
documentación
Notas del Comité
de Evaluación
22
Botas con punta de hierro
Cantidad: 120 (ciento veinte)
Botas de cuero color negro con punta metálica
Con la siguiente talla:
diez (10) talla 8, veinte (20) talla 7, veinte (20) talla 9,
cincuenta (50) talla 40, veinte (20) talla 42
23
Cascos de seguridad
Cantidad: 100 (cien)
EN397 – Cascos de seguridad para la industria
 Muy baja temperatura (-30°C),
 Aislamiento eléctrico (440 Vca)
 Copa en HDPE estabilizado contra UV
 Alto nivel en prestaciones mecánicas
 Gran confort con suspensión textil de ajuste
en altura
 Incorpora ranuras de 30mm para acoplar
protecciones auditiva / facial.
2013.1
c4f_annexiitechspeciiitechoffer_es
Página 47 de 213
1.
2.
3.
4.
5.
Número
del
artículo
Especificaciones requeridas
Especificaciones ofrecidas
Notas, observaciones,
referencia a la
documentación
Notas del Comité
de Evaluación
24
Dosificadores para BM
Cantidad: 6 (seis)
Dosificador volumétrico para medir la descarga de los
cilindros de bromuro de metilo. Tanque y protector de
acero inoxidable, permite medir la descarga de
bromuro en incrementos de 0.25 kg, entre 0.5 y 3.0 kg,
se muestra en un nivel de vidrio, que lo muestra en
kilos o libras.
Instrumento de precisión para aplicaciones en
tratamientos cuarentenarios a base de bromuro de
metilo.de preferencia marca FX-3.0
25
Botas de caucho color blanco
Cantidad: 50 (cincuenta) pares
Botas de Hule para el personal de campo el que se le
entregara un par de botas a cada uno. De la siguiente
talla:
diez (10) talla 8, diez (10) talla 7, diez (10) talla 9,
diez (10) talla 40, diez (10) talla 42
2013.1
c4f_annexiitechspeciiitechoffer_es
Página 48 de 213
1.
2.
3.
4.
5.
Número
del
artículo
Especificaciones requeridas
Especificaciones ofrecidas
Notas, observaciones,
referencia a la
documentación
Notas del Comité
de Evaluación
26
Navajas de acero inoxidables
Cantidad: 100 (cien)
Con los siguientes accesorios:
1.hoja grande
2. hoja pequeña
3. sacacorchos
4. abrelatas
5. -destornillador pequeño
6. destapador
7. -destornillador
8. -desaislador pelacables
9. punzón
10. Anillo inoxidable
11. pinzas
12. palillo de dientes
13. tijeras
14. Ganchos multiusos
15. sierra para madera
16. quitaescamas
17. -quita anzuelo
18. -regla (cm + pulgadas)
19. lima para uñas
20. -lima para metal
21. -limpia uñas
22. -sierra metálica
23. destornillador 2.5 mm
24. cincel
25. -alicate multiuso
26. -prensaterminales
27. - cortador de alambre
28. Destornillador de estrella
29. lupa
30. Bolígrafo de presión
31. alfiler (de acero inoxidable
2013.1
c4f_annexiitechspeciiitechoffer_es
Página 49 de 213
1.
2.
3.
4.
5.
Número
del
artículo
Especificaciones requeridas
Especificaciones ofrecidas
Notas, observaciones,
referencia a la
documentación
Notas del Comité
de Evaluación
27
Estuche de disección
Cantidad: 45 (cuarenta y cinco)
Estuche entomológico como apoyo para trabajo de
campo compuesto de tijeras, pinzas, lupa, agujas de
disección para manipulación de especímenes e
identificación de plagas. (2304x1728).
28
Contador de visitas manual mecanico 4 numeros
Cantidad: 50 (cincuenta)
Características:



29
Carcasa metal Cuenta de 0 a 9999
Reinicialización manual
Especificaciones: material:
o mecanismo: metal
o caja: metal pulido
dimensiones: 50 x 50 x 50mm
peso: no mayor de 80g
Sonda de alvéolo
Cantidad: 5 (cinco)
Las aberturas en el interior del tubo girar
alrededor para que se abra por primera vez en la parte
inferior y luego en pasos graduales hacia la parte
superior. Esto asegura una buena parte de las muestras
de grano tanto en niveles inferiores, como superior.
2013.1
c4f_annexiitechspeciiitechoffer_es
Página 50 de 213
1.
2.
3.
4.
5.
Número
del
artículo
Especificaciones requeridas
Especificaciones ofrecidas
Notas, observaciones,
referencia a la
documentación
Notas del Comité
de Evaluación
30
Calador Arroz
Cantidad: 20 (veinte)
Acero niquelado; 1 1/2 " de diámetro de salida en el
extremo de gran tamaño. La ranura es de 7 3 / 8 "de
largo, con un ancho Peso neto. 1lb peso envió. 2
lbs. Dimensiones. 12 "x 9" x 5 "de ranura superior de
1 1/4 "disminuyendo hasta ¼". Incluye funda
protectora
31
Máscaras full face (con filtro)
Cantidad: 60 (sesenta)
Pieza Facial : Polímero sintético. Color gris. Sello
facial: Silicona. Arnes: 4 puntos de ajuste. Visor:
Policarbonato. Banda elástica: Elastómero.
Comunicación: Sistema de cámara de amplificación.
32
Medias máscaras antigás (con filtro)
Cantidad: 74 (setenta y cuatro)
33
Medias máscaras antigás, gases, vapores y químicos
con sus 6000 serie del respirador
Trogotrampas
Cantidad: 1,000 (un mil)
Feromonas para detección de Gorgojo Kaprha en
granos de almacén y son llamadas trogotrampas
2013.1
c4f_annexiitechspeciiitechoffer_es
Página 51 de 213
1.
2.
3.
4.
5.
Número
del
artículo
Especificaciones requeridas
Especificaciones ofrecidas
Notas, observaciones,
referencia a la
documentación
Notas del Comité
de Evaluación
34
Trampas Mcphail
Cantidad: 1,500 (un mil quinientos)
Nombre especifico de la trampa Mcphail o Multilure,
color amarillo con tapadera transparente plástica con
capacidad de 300 ml de agua para control de moscas de
la fruta.(164x252)
35
Torula
Cantidad: 250 (doscientos cincuenta) kilos
Proteína hidrolizada o torula bórax, medio de atracción
alimenticia para control de moscas de la frutas y vienen
en presentación de tabletas de 0.5 mg.
36
Trampas Jackson
Cantidad: 3,000 (tres mil)
Esta trampa se utiliza para monitoreo de Mosca del
Mediterráneo (Ceratitis capitata), Mosca Oriental de
las Frutas (Bactroceradorsalis) y Mosca de las
Cucurbitáceas. TRAMPA JACKSON con estructura de
cartón de color blanco, denominado Delta o Prisma. En
la base interna se coloca una laminilla untada con el
pegante SAFERTAC y en la parte superior interna un
gancho metálico que soporta el algodón o un
dispensador plástico impregnado con el atrayente
sexual, que libera paulatinamente la
feromona.(164x252).
2013.1
c4f_annexiitechspeciiitechoffer_es
Página 52 de 213
1.
2.
3.
4.
5.
Número
del
artículo
Especificaciones requeridas
Especificaciones ofrecidas
Notas, observaciones,
referencia a la
documentación
Notas del Comité
de Evaluación
37
Trimedlure
Cantidad: 2,600 (dos mil seiscientos)
Tabletas plug para detección de mosca del
mediterraneo(Ceratitiscapitata)
38
Cuelure
Cantidad: 2, 000 (dos mil)
Tabletas plug para detección de mosca del melón
(Bactroceracucurbitae)
39
MethylEugenol
Cantidad: 2,000 (dos mil)
Tabletas plug para detección de mosca del melón
(Bactroceracucurbitae)
40
Gossyplure
Cantidad: 1,500 (un mil quinientos)
Feromona sexual para detección de gusano rosado
(Pectinophoragossypiella.
LOTE 3 – EQUIPO DE REFRIGERACIÓN
2013.1
c4f_annexiitechspeciiitechoffer_es
Página 53 de 213
1.
2.
3.
4.
5.
Número
del
artículo
Especificaciones requeridas
Especificaciones ofrecidas
Notas, observaciones,
referencia a la
documentación
Notas del Comité
de Evaluación
1
REFRIGERADORES COMERCIALES
Cantidad: 7 (siete)






2
Dimensiones: 1761x716x851
Parrillas anticorrosivas,
Acero inoxidable
dos puertas,
Sistema de deshielo automatico y control de
humedad.
No frost
Congelador
Cantidad: 3 (tres)
Especificaciones generales :











Verticales
Rango de temperatura (- 40 a -20) °C
Capacidad 13 pies cúbicos
369 litros
Color Blanco Voltaje (V) 115V/60Hz
Clase climática ST
Gas refrigerante R134a
Consumo de energia (kwh/24h) 1.8
Nivel de ruido (dB) 45
Panel de control electrónico digital.
Dimensiones 32.25”x66”x27.25
2013.1
c4f_annexiitechspeciiitechoffer_es
Página 54 de 213
1.
2.
3.
4.
5.
Número
del
artículo
Especificaciones requeridas
Especificaciones ofrecidas
Notas, observaciones,
referencia a la
documentación
Notas del Comité
de Evaluación
3
Vitrina Refrigerada (mostrador, exhibidor)
horizontal para exposición de carnes y aves (no
congeladas)
Cantidad: 26 (veintiseis)
Uso

Mantenimiento y Exposición de
productos cárnicos no congelados
Dimensiones promedio (ancho x alto x
profundidad)
 160 cm x 145 cm x 93 cm
Distribución
 4 bandejas de acero inoxidable
 Barra y Ganchos para colgar
 2 niveles de exhibición ajustables
Iluminación
 Lámparas fluorescente, interna
Rango de operación (temperatura de trabajo)
 0 a 7 grados centígrados
Consumo promedio de energía
 Kw/h/día 10.3
Control de temperatura
 Inteligente
 Incremento y decremento
Ventanas panorámicas

de cristal Curvo templado
Voltaje de trabajo/frecuencia/potencia
 120/240 voltio/50-60 Hertz/450
Watts/1Hp
2013.1
c4f_annexiitechspeciiitechoffer_es
Página 55 de 213
1.
2.
3.
4.
5.
Número
del
artículo
Especificaciones requeridas
Especificaciones ofrecidas
Notas, observaciones,
referencia a la
documentación
Notas del Comité
de Evaluación
Refrigeración combinada
Por gravedad y placa fría
Puertas
 Traseras, Corredizas
Estructura de aislamiento
 Poliuretano de alta densidad
Refrigerante
 Gas R-134a
Acabado exterior
 Piso y Techo de Acero Inoxidable
Acabado interior
 De acero inoxidable
Capacitación en el uso del equipo demostrar su
funcionamiento ver otrs lotes
 Incluir en oferta
Operación
 ciclo de deshielo manual
2013.1
c4f_annexiitechspeciiitechoffer_es
Página 56 de 213
1.
2.
3.
4.
5.
Número
del
artículo
Especificaciones requeridas
Especificaciones ofrecidas
Notas, observaciones,
referencia a la
documentación
Notas del Comité
de Evaluación
4
Vitrina Refrigerada (mostrador, exhibidor)
horizontal, para exposición de mariscos
refrigeración estática por placa fría
Cantidad: 25 (veinticinco)
Uso

Conservación y la exposición de
mariscos y/o ensaladas
Dimensiones promedio (alto x ancho x
profundidad)
 126 cm x 190 cm x 70 cm
Rango de operación (temperatura de trabajo)
 Temperatura: 1 ° a 7 ° C
Consumo promedio de energía
 6 kilowatt/hora/día
Control de temperatura
 Termostato
Ventanas
 Cristal Curvo templado
Voltaje de trabajo/frecuencia
 120/240 voltio/50-60 Hertz
Enfriamiento
 placa fría
Puertas
 corredizas de vidrio sencillo
Refrigerante
 Gas R-134ª
2013.1
c4f_annexiitechspeciiitechoffer_es
Página 57 de 213
1.
2.
3.
4.
5.
Número
del
artículo
Especificaciones requeridas
Especificaciones ofrecidas
Notas, observaciones,
referencia a la
documentación
Notas del Comité
de Evaluación
Acabado exterior
 De acero inoxidable
Acabado interior
 De acero inoxidable
Capacitación en el uso del equipo demostrar su
funcionamiento ver otrs lotes

Incluir en oferta
Operación
 refrigeración con ciclo de deshielo
manual
2013.1
c4f_annexiitechspeciiitechoffer_es
Página 58 de 213
1.
2.
3.
4.
5.
Número
del
artículo
Especificaciones requeridas
Especificaciones ofrecidas
Notas, observaciones,
referencia a la
documentación
Notas del Comité
de Evaluación
5
Vitrina Refrigerada (mostrador, exhibidor)
horizontal, para exposición de productos lacteos
Cantidad: 30 (treinta)
Capacidad

12 Pies cúbicos
Uso

Mantenimiento y Exposición de
productos lácteos (quesos, cremas, etc.)
Distribución
 3 niveles de exhibición ajustables
Dimensiones promedio (alto x ancho x
profundidad)
 145 cm x 100 cm x 91 cm
Iluminación
 Lámparas fluorescente interna
Rango de operación (temperatura de trabajo)
 2 a 5 grados centígrados
Consumo promedio de energía
 Kw/h/día 11
Control de temperatura
 Inteligente
 Incremento y decremento
Ventanas panorámicas

de cristal Curvo templado
Voltaje de trabajo/frecuencia/potencia
 120/240 voltio/50-60 Hertz/450
Watts/1Hp
2013.1
c4f_annexiitechspeciiitechoffer_es
Página 59 de 213
1.
2.
3.
4.
5.
Número
del
artículo
Especificaciones requeridas
Especificaciones ofrecidas
Notas, observaciones,
referencia a la
documentación
Notas del Comité
de Evaluación
Refrigeración combinada
 Por gravedad y placa fría
Puertas
 Traseras, Corredizas
Estructura de aislamiento
 Poliuretano de alta densidad
Refrigerante
 Gas R-134a
Acabado exterior
 Piso y Techo de Acero Inoxidable
Acabado interior
 De acero inoxidable
Capacitación en el uso del equipo demostrar su
funcionamiento ver otrs lotes

Incluir en oferta
Operación
 refrigeración con ciclo de deshielo
manual
2013.1
c4f_annexiitechspeciiitechoffer_es
Página 60 de 213
1.
2.
3.
4.
5.
Número
del
artículo
Especificaciones requeridas
Especificaciones ofrecidas
Notas, observaciones,
referencia a la
documentación
Notas del Comité
de Evaluación
6
Split
Cantidad: 7 (siete)
CARACTERISTICAS TECNICAS:





220 v / 60 HZ
24000 BTU
G panel
3m tubería de cobre
Refrigerante R22
ESPECIFICACIONES:






Ahorrador de energía
Sistema de flujo de aire silencioso.
Reinicio automático.
Timer programable de auto apagado
Circulación de aire continuo
Con Control remoto
2013.1
c4f_annexiitechspeciiitechoffer_es
Página 61 de 213
1.
2.
3.
4.
5.
Número
del
artículo
Especificaciones requeridas
Especificaciones ofrecidas
Notas, observaciones,
referencia a la
documentación
Notas del Comité
de Evaluación
7
Refrigerador/Congelador vertical de dos puertas
Cantidad: Tres (3)







Refrigerador vertical de dos puestas: Para
refrigeracion y para congelacion de productos
alimenticios, con reguladores de temperaturas
individuales, debe tener al menos 5
compartimentos de almacenaje por cada
puerta
Temperatura de refrigeracion: de 2 a 8 grados
celsius.
Temperatura de congelacion: menos 20
grados celsius.
Rango de altura entre 40 – 50 pulgadas
Rango de ancho entre 30 – 35 pulgadas
Rango de fondo entre 26 – 33 pulgadas
Requerimiento eléctrico: entre 115-120V,
50/60 Hz.
GARANTÍA:
12 meses de garantía como mínimo contra defecto de
manufactura y mal funcionamiento
2013.1
c4f_annexiitechspeciiitechoffer_es
Página 62 de 213
1.
2.
3.
4.
5.
Número
del
artículo
Especificaciones requeridas
Especificaciones ofrecidas
Notas, observaciones,
referencia a la
documentación
Notas del Comité
de Evaluación
8
Refrigerador con congelador vertical
Cantidad: Uno (1)









Rango de temperatura del refrigerador: 2° a
10°C, 17.1 cu. ft. (484L) con seis estantes
interiores y tres estantes en la puerta.
Rango de temperatura del congelador: -18° a 12°C, 7.6 cu. ft. (215L) con tres estantes
interiores
Circulación de aire forzado
Luz interior
Patas de nivelación
Dimensiones exteriores: 33L X 34.5W X
68”H (84 X 88 X 173 cm)
Refrigerante libre de CFC
Requerimientos eléctricos: 120V 60Hz
Vinilo blanco con textura de acero
GARANTÍA:



12 meses de garantía como mínimo contra
defectos de manufactura y funcionamiento.
Equipo completamente nuevo, fabricado con
materiales de primera calidad.
Manual de usuario preferiblemente en idioma
español
2013.1
c4f_annexiitechspeciiitechoffer_es
Página 63 de 213
1.
2.
3.
4.
5.
Número
del
artículo
Especificaciones requeridas
Especificaciones ofrecidas
Notas, observaciones,
referencia a la
documentación
Notas del Comité
de Evaluación
9
Congelador vertical
Cantidad: Uno (1)








Rango de temperatura (- 40 a -20) °C.
Debe incluir 5 cestos deslizables y removibles
2 Gavetas
Control electrónico externos
Función de congelado rápido
Pies niveladores con rueda
Dimensiones no mayores de 155 cm alto, 65
cm ancho, 75 cm profundidad
Requerimiento eléctrico: entre 110-120V
GARANTIA:

12 meses de garantía como mínimo contra
defecto de manufactura y mal funcionamiento.
2013.1
c4f_annexiitechspeciiitechoffer_es
Página 64 de 213
1.
2.
3.
4.
5.
Número
del
artículo
Especificaciones requeridas
Especificaciones ofrecidas
Notas, observaciones,
referencia a la
documentación
Notas del Comité
de Evaluación
10
Refrigerador para laboratorio
Cantidad: 4 (cuatro)
Rango de temperatura: 1 a 8oC
Capacidad: 181 L
Dimensiones:

Interior: 46 x 69 x 132 cm.

Exterior: 29 x 32 x 50 pulgadas.
Requerimiento eléctrico: 115V 50/60Hz
Garantía:

12 meses de garantía como mínimo contra
defectos de manufactura y funcionamiento..

Equipo completamente nuevo, fabricado con
materiales de primera calidad.

Garantía de repuestos de al menos 5 años,
después de descontinuada su fabricación.

Manual de usuario en idioma español
preferiblemente, en su defecto ingles.
LOTE 4 – EQUIPO PARA ANALISIS DE LABORATORIO
2013.1
c4f_annexiitechspeciiitechoffer_es
Página 65 de 213
1.
2.
3.
4.
5.
Número
del
artículo
Especificaciones requeridas
Especificaciones ofrecidas
Notas, observaciones,
referencia a la
documentación
Notas del Comité
de Evaluación
1
Sistema completo con todos los accesorios para
el análisis de alimentos, granos y forrajes
muestras molidas o enteras.
Cantidad: uno (1)
INFRAXACT FEED AND FORAGE
Análisis no destructivo de alimentos balanceados
para aves, cerdos, bovinos, mascotas, ovejas,
pescado y equinos.
Análisis rápido en menos de un minuto de proteína,
humedad, grasa, fibra y otros constituyentes.
Celdas para muestras molidas en granos y líquidos
SE REQUIERE QUE TENGA
 Un rango de longitud de onda de 570 a 1850
nm
 Detectores 70-1100Si/1100-1850INGaAs
 Temperatura de trabajo 0-40° C Identificador
automático de muestras
Que incluya




1 PCS. Analizador InfraXact sin ordenador
Cubeta pequeña
Cubeta tamaño grande
SofwareISIscan y 2.311 PCS
2013.1
c4f_annexiitechspeciiitechoffer_es
Página 66 de 213
1.
2.
3.
4.
5.
Número
del
artículo
Especificaciones requeridas
Especificaciones ofrecidas
Notas, observaciones,
referencia a la
documentación
Notas del Comité
de Evaluación














Fuente de alimentación cable USB
Soporte para cubeta pequeña
Manual de uso e Informe de funcionamiento
Cepillo
Cable de conexión corriente 230V
Cable de conexión corriente 110V
Llave allen 3mm para cambio de lámpara
Cerámica estándar
Celda de chequeo diario
Paquete de calibraciones de mezcla de
alimentos balanceados (10013191)
Paquete de calibraciones de materias primas
(10013196)
Molino Ciclotec 115 V
Frascos de vidrio para muestras de 125 ml 52/
paquete
Tamiz de 1 mm de acuerdo al molino
Instalación, entrenamiento y puesta en marcha
incluido por técnicos especializados

Entrenamiento de aproximadamente 2
semanas, al personal designado por la
institución para la utilización del equipo,
garantizando su total manejo operativo,
avalado por un certificado de la Empresa.

Levantamiento de una calibración básica con
los parámetros de Proteína, humedad, grasa y
fibra cruda. Para el caso de otros parámetros
se debe informar sobre la concentración
mínima y si esta puede ser detectada por el
infrarrojo
2013.1
c4f_annexiitechspeciiitechoffer_es
Página 67 de 213
1.
2.
3.
4.
5.
Número
del
artículo
Especificaciones requeridas
Especificaciones ofrecidas
Notas, observaciones,
referencia a la
documentación
Notas del Comité
de Evaluación
2
Sistema de cromatografia de gas con un Puerto de
inyeccion, un Detector µECD, Software de
operación, Inyector automatico y Columnas
capilares
Cantidad: uno (1)
CARACTERISTICAS GENERALES
 Operado y controlado mediante software, y desde
el teclado.
 Con control electrónico de flujo.
 Capacidad de diagnóstico durante la corrida.
 Capacidad de realizar chequeos electrónicos para
verificar su correcto funcionamiento de todas las
funciones del sistema.
 Capacidad de visualizar los distintos parámetros
de operación del equipo.
 Que tenga los accesorios necesarios para su
instalación y operación.
 Sistema incorporado de Buenas Prácticas de
Laboratorio (BPL).
 Sistema de programación mediante software.
 Control central de hasta 7 zonas de calentamiento
Horno
 Con capacidad de trabajo de temperatura
ambiente + 4 a 450 ºC en incrementos de 1ºC
2013.1
c4f_annexiitechspeciiitechoffer_es
Página 68 de 213
1.
2.
3.
4.
5.
Número
del
artículo
Especificaciones requeridas
Especificaciones ofrecidas
Notas, observaciones,
referencia a la
documentación
Notas del Comité
de Evaluación
 Debe permitir el uso de al menos 6 rampas de
temperatura con posibilidad de calentamiento de
hasta 120ºC/min.
 Velocidad de enfriamiento de 400° C a50° en
menos de 15 minutos
 Que cuente con auto diagnóstico al encenderse y
un autotest de fugas que se pueda realizar a
necesidad del usuario,
 Con zonas independientes de calentamiento: para
los inyectores, para los detectores y para los
auxiliares
 Debe poseer interfase LAN para control del
instrumento.
Puerto de inyección tipo split/splitless:

Temperatura máxima de trabajo 400ºC. o mas

con un ámbito de trabajo de 0 a 100 psi con
 Ámbito de trabajo para los flujos de gases de 0 a
200 mL/min.
Caracteristicas Detector µECD:
 Con control electrónico de todos los gases con un
ámbito de trabajo de 0 a 100 psi .
 Temperatura máxima de trabajo de 400 ºC.
 Con límites de detección de < 6 fg/ml como
lindano con Detector a 300 0C
 Ámbito dinámico de 105 para lindano.
 Compatible con columnas capilares.
2013.1
c4f_annexiitechspeciiitechoffer_es
Página 69 de 213
1.
2.
3.
4.
5.
Número
del
artículo
Especificaciones requeridas
Especificaciones ofrecidas
Notas, observaciones,
referencia a la
documentación
Notas del Comité
de Evaluación
Muestreador e inyector automatico
 Debe permitir seleccionar el tamaño de la
muestra, número de inyecciones, velocidad de la
inyección y debe permitir programar la inyección
automática, lavado de la jeringa, profundidad
variable de muestreo de la aguja. Y selección
aleatoria controlada desde el software.
 La reproducibilidad para las áreas debe ser
menor o igual a 0.3% RSD.
 La reproducibilidad para los tiempos de retención
debe ser menor o igual a 0.1% RSD.
 La bandeja muestreadora debe tener capacidad al
menos para 100 viales de 2 mL.
 Todo el sistema automuestreador debe manejarse
y operarse desde el equipo y el programa de
operación del equipo.
Software de Operación
 En idioma español o inglés que cumpla con una
norma de calidad (CFR parte 11) para asegurar
que el sistema trabaje aplicando las buenas
prácticas de laboratorio y cumpla con normas
internacionales de calidad.
 Comunicarse por medio de tarjeta LAN con el
equipo.
 Con aplicaciones típicas en cromatografía tales
como: Desarrollo y optimización de métodos,
visualización de cromatogramas en diferentes
formas, manipulación de cromatogramas para la
integración de las señales, identificación de
señales, como mínimo.
2013.1
c4f_annexiitechspeciiitechoffer_es
Página 70 de 213
1.
2.
3.
4.
5.
Número
del
artículo
Especificaciones requeridas
Especificaciones ofrecidas
Notas, observaciones,
referencia a la
documentación
Notas del Comité
de Evaluación
 Capacidad de calcular un resultado final sobre la
base de curvas de calibración utilizando estándar
interno o externo.
 Capacidad de operación y tratamiento de datos
mediante computadora que trabaje en plataforma
compatible Windows.
 Entregar un CD o disquetes de todo el software
necesario para la operación del equipo, son sus
respectivas licencias. y certificado de validación
Hardware
 Computadora de marca reconocida con
Procesador de última generación.
 Disco duro de al menos 160GB.
 Monitor pantalla plana a color, de al menos 38
cm, de alta resolución.
 Compatible en plataforma Windows con su
respectiva licencia.
 Lector de DVD, CD-ROM con escritor para CD
y quemador.
 Tarjeta de comunicación integrada, sistema
operativo instalada y respaldado en CD con su
respectiva licencia.
 Impresora láser
 Teclado y raton ergonomico
Accesorios
 Regulador de presión para cilindro de Nitrogeno
 3 columnas capilares de distinta polaridad:
2013.1
c4f_annexiitechspeciiitechoffer_es
Página 71 de 213
1.
2.
3.
4.
5.
Número
del
artículo
Especificaciones requeridas
Especificaciones ofrecidas
Notas, observaciones,
referencia a la
documentación
Notas del Comité
de Evaluación



Columna capilar DB-1, 30 m, 0.254 mm
x 0.25 µm
Columna capilar DB-5, 30 m x 0.32 mm
x 0.25 µm
1 Columna capilar DB-1701, 30m x
0.32mm x 0.25µm
GARANTIAS
 12 meses de garantía como mínimo contra
defectos de manufactura y funcionamiento.
Durante el período de la garantía, efectuar las
reparaciones, revisiones y sustitución de piezas
dañadas por sin costo adicional para la
instituciónGarantía de repuestos, por un período
mínimo de 5 años, después de descontinuado el
equipo.
 Equipo de última generación, completamente
nuevo, fabricado con materiales de primera
calidad.
 El oferente de preferencia debe contar con
inventario de repuestos básicos y personal
técnico capacitado, así como soporte técnico en
el país.
Instalacion y entrenamiento
 El equipo será instalado en el Laboratorio de
Residuos Biológicos y se deberá demostrar su
funcionamiento con muestras de interés para el
laboratorio durante el período de entrenamiento.
2013.1
c4f_annexiitechspeciiitechoffer_es
Página 72 de 213
1.
2.
3.
4.
5.
Número
del
artículo
Especificaciones requeridas
Especificaciones ofrecidas
Notas, observaciones,
referencia a la
documentación
Notas del Comité
de Evaluación

Entrenamiento de aproximadamente 2 semanas, al
personal designado por la institución para la
utilización del equipo, garantizando su total
manejo operativo, avalado por un certificado de la
Empresa.
 La instalación deberá incluir la cualificación del
equipo en el detector El entrenamiento debe ser
impartido por un experto en el tema.
.
 Deben suministrarse los manuales de operación y
mantenimiento de cada una de las partes del
equipo, en idioma español.
 Debe incluirse el plan de mantenimiento
preventivo y la verificación que se dará al equipo
durante el periodo de garantía, para su evaluación
por parte del laboratorio.
Todo el sistema debe tener un requerimiento eléctrico
de 110-120V, 50/60 Hz.
2013.1
c4f_annexiitechspeciiitechoffer_es
Página 73 de 213
1.
2.
3.
4.
5.
Número
del
artículo
Especificaciones requeridas
Especificaciones ofrecidas
Notas, observaciones,
referencia a la
documentación
Notas del Comité
de Evaluación
3
Sistema de cromatografia liquida con un detector
de fluorescencia, bomba cuaternaria,
automuestreador, software de operación
Cantidad: uno (1)
ESPECIFICACIONES PARA LA BOMBA
 Bomba cuaternaria de doble pistón conectado en
serie.
 Con un programa de Auto diagnóstico de fugas y
que detenga la bomba en forma automática, en
caso de presentarse derrame de disolvente.
 Con sistema integrado de desgasificación.
 Con capacidad de elución isocrática y gradiente
 Rango de la composición de solventes: 0-100%,
con incrementos de 0.1% Rango de flujo de 0.001 – 10.000 ml/min.
 Con bandeja para colocar cuatro recipientes de
disolvente.
 Deben incluirse cuatro envases de 1L c/u
 Con sistema de lavado de sellos, para evitar
depósitos de buffer por cristalización.
 Debe incluir todas las partes consumibles para
la bomba, tuberías de conexión, tuberías de
acero inoxidable, tuberías del tipo no metálicas
peek, cables y lo necesario para su inmediata
instalación y funcionamiento.
2013.1
c4f_annexiitechspeciiitechoffer_es
Página 74 de 213
1.
2.
3.
4.
5.
Número
del
artículo
Especificaciones requeridas
Especificaciones ofrecidas
Notas, observaciones,
referencia a la
documentación
Notas del Comité
de Evaluación
 Incluir un kit de consumibles para un año de
trabajo continuo: 4 unidades de sellos de pistón,
4 unidades de filtros para los disolventes, 4
unidades de filtros de entrada, 4 unidades de
diafragmas y 4pistones, 4 sellos.
ESPECIFICACIONES DETECTOR DE
FLUORESCENCIA
 Detección del tipo de:
 Multi-señal del detector de fluorescencia
con una rápida capacidad de escaneo en
línea y el análisis de los datos espectrales.
 Fuente de luz
 Lámpara de flash de xenón, larga duración
 Monocromador de excitación
 Rango 200 - 1000 nm o mejor
 Monocromador de emisión
 Rango 280 - 1000 nm o mejor
 Operación de longitud de onda sencilla.
AUTOMUESTREADOR
 Debe tener capacidad para un mínimo de 100
viales, de 2 ml
 Con jeringa para inyección automática
 Loop estándar de 100 µL
 Volúmenes de inyección programables.
 Lavado programable de la aguja
2013.1
c4f_annexiitechspeciiitechoffer_es
Página 75 de 213
1.
2.
3.
4.
5.
Número
del
artículo
Especificaciones requeridas
Especificaciones ofrecidas
Notas, observaciones,
referencia a la
documentación
Notas del Comité
de Evaluación
 La variación de los tiempos de retención de los
picos deben ser inferior a 0.1 min.
 Rango en el volumen de inyección; 0.1- 100 ul,
 Con un rango de temperatura de 5- 40 º C, para
la bandeja de viales.
 Debe tener funciones tales como vial prioritario,
diluciones, adición de estándar interno.
 Control total de las funciones desde el software
de operación.
 Debe permitir hacer diluciones en serie.
 Debe realizar funciones tales como la adición de
muestras a una secuencia sin necesidad de parar
la misma.
Horno de columna
 Con capacidad para almacenar 2 columnas o mas
de 30 cm de largo
 Rango de temperatura 25ºC a 60 o mas en
incrementos de 0.1ºC.
 Estabilidad e la temperatura 0.1 ºC
 Reproducibilidad de la temperatura 0.1 ºC.
 Control desde el equipo desde el programa de
operación
 Sistema de seguridad contra sobre calentamiento
SOFWARE DE OPERACION
 Operar con ambiente Windows.
2013.1
c4f_annexiitechspeciiitechoffer_es
Página 76 de 213
1.
2.
3.
4.
5.
Número
del
artículo
Especificaciones requeridas
Especificaciones ofrecidas
Notas, observaciones,
referencia a la
documentación
Notas del Comité
de Evaluación
 Debe tener capacidad para manejar todas las
partes que integran el sistema cromatográfico y
diagnosticar problemas de operación en el
sistema (detector, bomba, automuestreador,
horno).
 El software debe permitir crear, editar, llamar o
modificar un método mientras otro esté operando
 Debe permitir la superposición de
cromatogramas de inyecciones consecutivas
realizadas.
 Debe contar con los modos usuales de
integración como curva de calibración, método
de estándar interno, con sistema incorporado de
registro de firmas para evitar la alteración de los
datos.
 Debe tener incorporado un tipo de reporte para la
validación de métodos.
 Suministrar el programa de operación con su
respectiva licencia y un certificado de validación
del mismo.
Harware
 Computadora de marca reconocida con
Procesador 2.8 GHz o mejor.
 Compatible plataforma Windows con sus
respectivas licencias.
 Pantalla plana de 38cm o mas
 Memoria RAM de 2,0 GB o mejor.
 Disco duro de 250 GB o superior
 Lector de DVD, CD-ROOM Unidad CD
escritura/DVD 52X o mejor.
 Teclado en español y Mouse óptico.
2013.1
c4f_annexiitechspeciiitechoffer_es
Página 77 de 213
1.
2.
3.
4.
5.
Número
del
artículo
Especificaciones requeridas
Especificaciones ofrecidas
Notas, observaciones,
referencia a la
documentación
Notas del Comité
de Evaluación
 Impresora laser, impresión en blanco y negro,
compacta,
 Incluir 2 tonner de tinta.
 Requerimiento eléctrico para todo el
cromatógrafo: 110-115V, 50/60.
COLUMNAS Y ACCESORIOS
Columnas de fase reversa:
 1 columna Lichrosphere C18, 10 cm x 5µm , con
precolumnas
 1 Columna ODS Hypersil C18 µm x 200mm x
4.6 mm, con precolumnas
 1 Columna Zorbax ODS 4.6 mm x 15 cm x C18,
con precolumnas
 1 Columna Zorbax Eclipse XDB, C18 x 4.6mm ,
con precolumnas
 Kit de conectores de acero inoxidable
 Tuberia peek de teflón para flujo de solventes
 Todos los accesorios necesarios para la
instalación y operación del equipo.
INSTALACION Y MANTENIMIENTO
 El equipo será instalado en el Laboratorio de
Residuos Biológicos y se deberá demostrar su
funcionamiento con muestras de interés para el
laboratorio durante el período de entrenamiento.

Entrenamiento de aproximadamente 2 semanas, al
personal designado por la institución para la
utilización del equipo, garantizando su total
manejo operativo, avalado por un certificado de la
2013.1
c4f_annexiitechspeciiitechoffer_es
Página 78 de 213
1.
2.
3.
4.
5.
Número
del
artículo
Especificaciones requeridas
Especificaciones ofrecidas
Notas, observaciones,
referencia a la
documentación
Notas del Comité
de Evaluación
Empresa.

 La instalación deberá incluir la cualificación del
equipo en el detector El entrenamiento debe ser
impartido por un experto en el tema.
 El adjudicatario al final del entrenamiento deberá
entregar certificado correspondiente a cada
persona entrenada.
 Deben suministrarse los manuales de operación y
mantenimiento de cada una de las partes del
equipo, en idioma español preferiblemente.
 Debe incluirse el plan de mantenimiento
preventivo y la verificación que se dará al equipo
durante el periodo de garantía, para su evaluación
por parte del laboratorio.
 De preferencia el proveedor contara con personal
capacitado disponible en el país para el evacuo de
consultas telefónicas o vía electrónica, sobre uso
y manejo del equipo por parte del personal del
laboratorio.
GARANTIAS
 12 meses de garantía como mínimo contra
defectos de manufactura y funcionamiento.
Durante el período de la garantía, efectuar las
reparaciones, revisiones y sustitución de piezas
dañadas sin costo adicional para la institución.
2013.1
c4f_annexiitechspeciiitechoffer_es
Página 79 de 213
1.
2.
3.
4.
5.
Número
del
artículo
Especificaciones requeridas
Especificaciones ofrecidas
Notas, observaciones,
referencia a la
documentación
Notas del Comité
de Evaluación
 Garantía de repuestos, por un período mínimo de
5 años, después de descontinuado el equipo.
 Equipo de última generación, completamente
nuevo, fabricado con materiales de primera
calidad.
 De preferencia el oferente debe contar con
inventario y repuestos básicos y personal técnico
capacitado, así como soporte técnico en el país.

4
GENERADOR DE GRADO AIRE CERO (UHP)Ultra High Purity
Cantidad: uno (1)








Que genere al menos 1000 cc/min
Con compresor de aire silencioso
1 Kit de filtros para mantenimiento
Instalacion en equipos cromatograficos y
pruebas de eficacia
Trampas de humedad, hidrocarburos y oxígeno.
Rango de temperatura debe ser como mínimo
300 °C
Velocidad de agitación de al menos 1200 rpm
Garantía de al menos 1 año.
2013.1
c4f_annexiitechspeciiitechoffer_es
Página 80 de 213
1.
2.
3.
4.
5.
Número
del
artículo
Especificaciones requeridas
Especificaciones ofrecidas
Notas, observaciones,
referencia a la
documentación
Notas del Comité
de Evaluación
5
GENERADOR DE NITROGENO DE ALTA
PUREZA
Cantidad: uno (1)




Que genere al menos 3000 cc/min
Con compresor integrado libre de aceite .
Trampas de humedad, hidrocarburos y oxígeno.
Instalacion en equipos cromatograficos y
pruebas de eficacia.
 Garantía de al menos 1 año
2013.1
c4f_annexiitechspeciiitechoffer_es
Página 81 de 213
1.
2.
3.
4.
5.
Número
del
artículo
Especificaciones requeridas
Especificaciones ofrecidas
Notas, observaciones,
referencia a la
documentación
Notas del Comité
de Evaluación
6
Espectrofotómetro UV para cuantificar proteínas y
ADN
Cantidad: Uno (1)















Espectrofotómetro UV que permita que las
muestras se han pipeteadas directamente
dentro de la superficie óptica de lectura y
también que integre sistema de retención de la
muestra y capacidad de cubeta.
Micro-volumen de muestra (0,5-2.0 uL)
Métodos preconfigurado para A260,
A280,para cuantificar ADN.
Doble modos de elegir: cubeta o pedestal
Fuente de luz: Xenon flash
Tipo de detector: CCD silicon lineal 2048
Rango de longitud de onda: 190 to 840nm
Precision: 1nm
Resolución espectral: <=1.8 nm
Precisión de absorbancia de 0.002 A (1mm
path)
Rango de absorbancia: 0.04 to 300
Tiempo de lectura: <5 sec.
Requerimiento eléctrico: 115-120 voltios,
50/60 Hz
Material del pedestal: 303 acero inoxidable y
fibra de cuarzo.
Sistema de cubeta: Temperatura 37°C; mezcla
150 a 850 rpm; Altura Z 8.5 mm; dimensión
de la cubeta 12.5 x 12.5mm; Rango de
absorbancia 0.008 a 1.5.
2013.1
c4f_annexiitechspeciiitechoffer_es
Página 82 de 213
1.
2.
3.
4.
5.
Número
del
artículo
Especificaciones requeridas
Especificaciones ofrecidas
Notas, observaciones,
referencia a la
documentación
Notas del Comité
de Evaluación


Compatible con plataforma Windows
Debe incluir entrenamiento en el uso del
equipo para 5 personas (local).
GARANTÍA:

12 meses de garantía como minimo contra
defecto de manufactura y mal
funcionamiento.
2013.1
c4f_annexiitechspeciiitechoffer_es
Página 83 de 213
1.
2.
3.
4.
5.
Número
del
artículo
Especificaciones requeridas
Especificaciones ofrecidas
Notas, observaciones,
referencia a la
documentación
Notas del Comité
de Evaluación
7
Lector de absorbancia de microplacas para ELISA.
Cantidad: Uno (1)












Lector de absorbancia que ofrezca una rápida
lectura de 6 segundos. Con formato de placas
96 pozos
Rango de longitud de onda: 400-750 nm
Rango fotométrico: 0.000-3.5 OD
Linealidad: Menor del 2.0 %
Precisión: 1.0 % o 0.005 OD
Resolución: 0.001 OD
Filtros preinstalados: 415, 450, 490, 595, 655
y 750 nm.
Homogeneizador de placas.
Software interno con impresora térmica,
cables de poder.
Equipo debe leer microplacas con fondo U y
fondos V
Requerimiento eléctrico: 115-120 voltios,
50/60 Hz
Garantía: 12 meses de garantía como minimo
contra defecto de manufactura y mal
funcionamiento.
2013.1
c4f_annexiitechspeciiitechoffer_es
Página 84 de 213
1.
2.
3.
4.
5.
Número
del
artículo
Especificaciones requeridas
Especificaciones ofrecidas
Notas, observaciones,
referencia a la
documentación
Notas del Comité
de Evaluación
8
Lavador de microplacas.
Cantidad: Uno (1)





Lavador de microplascas para la realizacion
de inmunoensayos exactos y reproducibles en
un formato de microplacas como ELISA.
Adecuado para la esterilizacion por autoclave.
Compatible con microplacas de 96 posos que
tengan fondo en forma de U y fondo en forma
de V.
Requerimiento eléctrico: 115-120 voltios,
50/60 Hz
Pantalla LCD.
GARANTÍA:

12 meses de garantía como minimo contra
defecto de manufactura y mal funcionamiento.
2013.1
c4f_annexiitechspeciiitechoffer_es
Página 85 de 213
1.
2.
3.
4.
5.
Número
del
artículo
Especificaciones requeridas
Especificaciones ofrecidas
Notas, observaciones,
referencia a la
documentación
Notas del Comité
de Evaluación
9
Espectrofotómetro UV /VIS
Cantidad: Uno (1)
 Debe contar con un sistema óptico por arreglo de
diodos
 Intervalo de longitudes de onda: 190 – 1100 nm.
 Ancho de banda: fija menor de 1nm.
 Exactitud en la longitud de onda: ≤ ± 0,2 nm
 Exactitud en las mediciones de absorbancia: ≤
0,005 Abs.
 Repetibilidad de la longitud de onda: ≤ ± 0,02 nm
 Luz dispersa: ≤ 0,03%
 Estabilidad fotométrica: < 0,001 A/hora
 Test de resolución espectral con tolueno en
hexano: > 1,6
 Precisión fotométrica: < ± 0,005 A
 Ruido fotométrico: < 0,002 A
 Estabilidad de la línea base: < 0,001 A
 Tiempo típico de scan de 190 a 1100 nm: 1,5
segundos
 Tiempo mínimo de medición : 0,1 segundos
 El equipo debe tener una óptica fija (sin partes
móviles) que no sea afectado por
descalibraciones por el uso diario, movimientos,
golpes, etc.
 El sistema debe trabajar con una lámpara de
tungsteno y una lámpara de deuterio, y permitir
el encendido y apagado independiente de cada
lámpara.
 Debe contar con una bomba peristáltica con celda
de flujo de 10 mm de paso óptico y la tubería
necesaria.
2013.1
c4f_annexiitechspeciiitechoffer_es
Página 86 de 213
1.
2.
3.
4.
5.
Número
del
artículo
Especificaciones requeridas
Especificaciones ofrecidas
Notas, observaciones,
referencia a la
documentación
Notas del Comité
de Evaluación
REQUISITOS DEL SISTEMA OPERATIVO
 Debe permitir la operación del equipo, recepción,
procesamiento y tratamiento de datos así como el
control total del Espectrofotómetro Ultravioleta
Visible, de tal forma que permita el
establecimiento, modificación y monitoreo de
todos los parámetros, que posea rutinas de autodiagnóstico, validación del sistema, ayuda en
línea, y que permita el uso de tutoriales que
faciliten su uso.
 Debe ser compatible con ambiente Windows.
 Debe permitir la corrección de la línea base del
espectro, trabajar con derivadas de hasta cuatro
órdenes para diferenciar picos pequeños de los
grandes, detectar alturas de picos del espectro
empleando los métodos de corrección de línea
base de dos puntos o tres puntos.
 Debe tener capacidad de trabajar en funciones
multitarea, permitiendo accesar a hojas
electrónicas y procesadores de palabras, mientras
se recolectan los datos.
 Debe permitir el reprocesamiento, reintegración y
sobre posición de espectros.
 Debe tener la capacidad de realizar tareas como
curvas de calibración, funciones gráficas,
cuantificación, búsqueda de picos, análisis a una
longitud de onda, análisis a múltiples longitudes
de onda, almacenamiento de datos, generación de
reportes, para ello trabaja de acuerdo a los
protocolos de control de calidad incorporados
para el cumplimiento de buenas prácticas de
laboratorio (GLP).
2013.1
c4f_annexiitechspeciiitechoffer_es
Página 87 de 213
1.
2.
3.
4.
5.
Número
del
artículo
Especificaciones requeridas
Especificaciones ofrecidas
Notas, observaciones,
referencia a la
documentación
Notas del Comité
de Evaluación
 Debe contar con rutinas de diagnóstico del
funcionamiento del sistema, para realizar
chequeos periódicos y que además sea capaz
durante el trabajo diario de detectar y
diagnosticar problemas de operación del sistema.
 Debe tener integrado el protocolo del fabricante
para realizar la verificación del desempeño del
equipo en su totalidad, incluyendo la
comprobación del software contra errores. Se
debe poder verificar los siguientes parámetros:
 Exactitud y reproducibilidad de longitud de
onda
 Exactitud y estabilidad fotométrica
 Luz dispersa
 Resolución Ruido
 Estabilidad de línea base
Debe poseer la capacidad de diferenciar los
usuarios mediante nombre de usuario y palabras
claves, para poder diferenciar los usuarios
administradores del sistema de los usuarios
ordinarios
El reporte generado debe incluir:






Nombre del operador
Información del método utilizado
Espectros de las muestras analizadas
Tipo de calibración
Identificación de la muestra
Absorbancia para cada longitud de onda
fijada y concentración calculada

Debe permitir la impresión de un reporte con
los espectros de las muestras de calibración,
los valores tabulados y la curva de calibración
2013.1
c4f_annexiitechspeciiitechoffer_es
Página 88 de 213
1.
2.
3.
4.
5.
Número
del
artículo
Especificaciones requeridas
Especificaciones ofrecidas
Notas, observaciones,
referencia a la
documentación
Notas del Comité
de Evaluación
de trabajo.

Debe incluir la licencia respectiva y el
certificado de validación del software.

En idioma español o inglés que cumpla con
una norma de calidad (CFR parte 11) para
asegurar que el sistema trabaje aplicando las
buenas prácticas de laboratorio y cumpla con
normas internacionales de calidad.

Se debe de entregar e instalar en el equipo, las
actualizaciones del software que realice el
fabricante por un lapso de cinco años, sin
costo adicional.

Debe de tener incorporado un tipo de reporte
para la validación de métodos
Procesador de datos









Procesador 3,2 GHz o mejor.
Monitor a color de 43 cm (17 pulgadas),
pantalla LCD.
Memoria RAM de 2 GB o mayor.
Disco duro de 250 GB o mayor.
Unidad de disco suave de 1.44 MB.
Unidad de CD writer/DVD-RW, 52X o mejor.
Teclado en español. Ratón (mouse) óptico.
Compatible con ambiente Windows, con su
respectiva licencia.
Con sistema de impresión láser
2013.1
c4f_annexiitechspeciiitechoffer_es
Página 89 de 213
1.
2.
3.
4.
5.
Número
del
artículo
Especificaciones requeridas
Especificaciones ofrecidas
Notas, observaciones,
referencia a la
documentación
Notas del Comité
de Evaluación
GARANTÍA:
 12 meses de garantía contra defectos de
manufactura y funcionamiento. Durante el
periodo de la garantía efectuar las reparaciones,
revisiones y sustitución de piezas dañadas sin
costo adicional.
 Equipo completamente nuevo, fabricado con
materiales de primera calidad.
 Garantía de repuestos de al menos 5 años,
después de descontinuada su fabricación.
 Que tenga de preferencia soporte técnico en el
país, inventario de repuestos básicos y personal
técnico capacitado.

 Manual de usuario en idioma español
preferiblemente
INSTALACIÓN Y ENTRENAMIENTO:
 La instalación debe incluir la verificación
completa de funcionamiento con certificado
(OQ/PV). Instalación del mismo bajo el
procedimiento oficial del fabricante (IQ).
2013.1
c4f_annexiitechspeciiitechoffer_es
Página 90 de 213
1.
2.
3.
4.
5.
Número
del
artículo
Especificaciones requeridas
Especificaciones ofrecidas
Notas, observaciones,
referencia a la
documentación
Notas del Comité
de Evaluación

Entrenamiento de aproximadamente 2 semanas, al
personal designado por la institución para la
utilización del equipo, garantizando su total
manejo operativo, avalado por un certificado de la
Empresa.
 Deben suministrarse los manuales de operación y
mantenimiento de cada una de las partes del
equipo, en idioma español preferiblemente
 Debe incluirse el plan de mantenimiento
preventivo y la verificación que se dará al equipo
durante el periodo de garantía
 Todo el sistema debe tener un requerimiento
eléctrico de 110-120V, 50/60Hz. con conectores
incluidos.
2013.1
c4f_annexiitechspeciiitechoffer_es
Página 91 de 213
1.
2.
3.
4.
5.
Número
del
artículo
Especificaciones requeridas
Especificaciones ofrecidas
Notas, observaciones,
referencia a la
documentación
Notas del Comité
de Evaluación
10
CROMATOGRAFO LÍQUIDO (HPLC)
Cantidad: Uno (1)
Sistema de bombeo:













Bomba cuaternaria de doble pistón conectado
en serie.
Mezcla cuaternaria a baja presión.
Con capacidad de elusión isocrática y
gradiente.
Rango de la composición de solventes: 0100%, con incrementos de 0.1%
Precisión de la composición: < 0.2% RSD, de
0.2 a 2ml/min.
Exactitud de la composición: ± 0.5%
Rango de flujo de 0.001 – 10.000 ml/min,
con incrementos de 0.001 ml/min.
Precision del flujo: <0.05% RSD
Exactitud del flujo: ±0.1
Debe contar con compartimiento o bandeja
para colocar cuatro recipientes de disolvente.
Debe contar con un sistema de lavado de
sellos, para evitar depósitos de buffer por
cristalización.
Debe contar con un programa de Auto
diagnóstico de fugas y que detenga la bomba
en forma automática, en caso de presentarse
derrame de disolvente.
Debe permitir la lectura de la presión en PSI,
MPA y BAR.
 Presión de trabajo: no menor a 400 PSI, con
límites de presión altos y bajos a selección del
2013.1
c4f_annexiitechspeciiitechoffer_es
Página 92 de 213
1.
2.
3.
4.
5.
Número
del
artículo
Especificaciones requeridas
Especificaciones ofrecidas
Notas, observaciones,
referencia a la
documentación
Notas del Comité
de Evaluación
usuario en incrementos de 1 BAR.
 El sistema de cromatografía conformado por
diferentes partes, está diseñado para instalarse en
forma de torre para economizar espacio.
 Debe permitir un mantenimiento por el usuario
sin desmontar el sistema de torre, por lo que las
tuberías y conexiones deben estar ubicadas en la
parte frontal del instrumento.
 El sistema de bombeo debe operar desde el
software de operación a través de
microprocesador o de un sistema controlador o
módulo de control, el cual debe incluirse.
 Debe incluir un sistema integrado de
desgasificación por vacío en línea, programable
para cada diluyente. Capacidad de
desgasificación de hasta cuatro líneas de flujo
simultáneamente.
 Deben incluirse cuatro envases de 1L c/u, así
como todas las partes consumibles para la
bomba, tuberías de conexión, tuberías de acero
inoxidable, tuberías del tipo no metálicas peek,
cables y lo necesario para su inmediata
instalación y funcionamiento.
Detector UV/Vis de Arreglo de Diodos
Detector de arreglo de diodos
 De alta sensibilidad, con rango de 0,0001-2,0000
AUFS.
 Resolución espectral mínima : <1.0 nm por
fotodiodo
 Rango de longitud de onda mínimo: 190-900 nm
2013.1
c4f_annexiitechspeciiitechoffer_es
Página 93 de 213
1.
2.
3.
4.
5.
Número
del
artículo
Especificaciones requeridas
Especificaciones ofrecidas
Notas, observaciones,
referencia a la
documentación
Notas del Comité
de Evaluación
 Exactitud de la longitud de onda: ± 1 nm
 Linealidad: >2 AU (unidades de absorbancia), <5
% a 2 AU en todas las longitudes de onda.
 Velocidad de adquisición de datos de al menos
80 Hz para permitir trabajo en cromatografía
súper rápida, para el ahorro del tiempo de
análisis, y con una capacidad de trabajo de al
menos 8 señales simultáneas durante una corrida.
 El detector debe tener la capacidad de trabajar en
2 y 3 dimensiones y con capacidad de realizar
análisis de pureza óptica, para la determinación
de impurezas.
 Fuente de luz: lámpara de deuterio y tungsteno.
Deriva: <1 x 10 ˉ ³ AU /hora, a 254 nm.
 Ruido: ± 0.9 x 10ˉ5 AU, a 254 nm.
 Debe tener la capacidad de trabajar en y 3
dimensiones con capacidad de realizar análisis de
pureza óptica, para la determinación de
impurezas
 Debe contar con programa de autodiagnóstico
automático (GPL) que registre el mantenimiento
y los errores de operación y verifique la longitud
de onda, la energía de la lámpara y el número de
horas de trabajo de la lámpara, con monitoreo de
todas las funciones.
 Debe tener un censor de fugas para el detector y
un sistema de reemplazo para cada lámpara que
apaga la misma en forma automática.
 El equipo debe tener incluido en su diseño, el
filtro de holmio para la verificación de la
exactitud de la longitud de onda.

El detector debe controlarse en su
totalidad desde el programa de operación
2013.1
c4f_annexiitechspeciiitechoffer_es
Página 94 de 213
1.
2.
3.
4.
5.
Número
del
artículo
Especificaciones requeridas
Especificaciones ofrecidas
Notas, observaciones,
referencia a la
documentación
Notas del Comité
de Evaluación
Sistema Automuestreador e inyector
 Debe tener capacidad para un mínimo de 100
viales, de 2 ml.
 Que sea un sistema rápido en su forma de
muestreo, para ahorrar tiempo en la recolección
de los viales y producir más inyecciones por
unidad de tiempo.
 La variación de los tiempos de retención de los
picos deben ser inferior a 0.1 min.
 Rango en el volumen de inyección; 0.1- 100 ul,
con incrementos de 0.1 ul.
 Precisión de muestreo: < 0.25% RSD, para
inyecciones de 5 a 100 ul.
 Arrastre de muestra: < 0.01 %
 Linealidad con un coeficiente de correlación
mayor a 0.99
 Debe contar con un control de temperatura para
la bandeja de viales, programable desde el
sistema de operación, lo que permite controlar la
estabilidad de las muestras y volatilización de
solventes.
 Con un rango de temperatura de 5- 40 º C, para la
bandeja de viales.
 Debe tener funciones tales como vial prioritario,
diluciones, adición de estándar interno.
 Con profundidad de aguja programable
 Control total de las funciones desde el software
de operación
2013.1
c4f_annexiitechspeciiitechoffer_es
Página 95 de 213
1.
2.
3.
4.
5.
Número
del
artículo
Especificaciones requeridas
Especificaciones ofrecidas
Notas, observaciones,
referencia a la
documentación
Notas del Comité
de Evaluación
 Diseño compacto integrado al sistema de tal
manera que el volumen interno entre el punto de
inyección y el detector sea muy bajo.
 El sistema debe permitir almacenar un número
ilimitado de métodos.
 El software debe permitir crear, editar, llamar o
modificar un método mientras otro esté
operando.
 Debe permitir hacer diluciones en serie.
 Debe realizar funciones tales como la adición de
muestras a una secuencia sin necesidad de parar
la misma.
 Debe tener funciones como el vial prioritario y
auto-adiciones para realizar la adición de
reactivos.
 Las bandejas para los viales deben ser
codificadas
Horno para columna
 Rango de temperatura: enfriar hasta 10ºC, por
debajo de la temperatura ambiente y calentar
hasta 60ºC, con una precisión de ± 0.1º C.
 Sistema de seguridad contra sobre calentamiento
y sistema de detección de fugas, de tal forma que
detiene la operación del equipo.
 Debe integrar un módulo de identificación y
registro automático de columnas.
 Control desde el equipo o desde el programa de
operación (software).
 Con capacidad para tres columnas de 30 cm de
largo.
2013.1
c4f_annexiitechspeciiitechoffer_es
Página 96 de 213
1.
2.
3.
4.
5.
Número
del
artículo
Especificaciones requeridas
Especificaciones ofrecidas
Notas, observaciones,
referencia a la
documentación
Notas del Comité
de Evaluación
Programa de operación







Debe tener capacidad para manejar todas las
partes que integran el sistema cromatográfico y
compatible con ambiente Windows.
Debe ser un sistema de fácil uso con interfase
gráfica con íconos que representen cada módulo,
y que permita acceder las diferentes funciones y
opciones para manejar, controlar y verificar
todo el sistema, conformado por detector, bomba,
sistema automuestreador e inyector y el horno
Sobre el detector de diodos, el programa debe
permitir al usuario realizar un chequeo del mismo
que evalúe y registre los parámetros de
operación, la calibración del mismo y
optimización de la lámpara, de tal manera que
permita la comprobación de su funcionamiento
en cualquier momento.
Debe tener la capacidad de permitir en el
momento de la corrida, la visualización
simultánea en la misma pantalla, del espectro de
absorbancia de cada pico y la imagen en tres
dimensiones del cromatograma, de tal forma que
no se requiera la apertura de otras ventanas para
facilitar el uso del software.
Debe permitir la superposición de
cromatogramas de inyecciones consecutivas
realizadas.
Debe contar con los modos usuales de
integración como curva de calibración, método
de estándar interno, método de normalización.
Debe realizar el cálculo de los platos teóricos de
la columna y permitir su inclusión en el reporte.
2013.1
c4f_annexiitechspeciiitechoffer_es
Página 97 de 213
1.
2.
3.
4.
5.
Número
del
artículo
Especificaciones requeridas
Especificaciones ofrecidas
Notas, observaciones,
referencia a la
documentación
Notas del Comité
de Evaluación





Debe tener incorporada la ejecución de rutinas de
diagnóstico de funcionamiento de todo el
sistema, para realizar chequeos cuando el usuario
lo requiera y mantener dichos registros. Además
debe ser capaz durante el trabajo diario, de
detectar y diagnosticar problemas de operación
en el sistema (detector, bomba, automuestreador,
horno) y señalarlo al usuario.
Debe tener incorporado el registro de firmas y un
alto nivel de seguridad para los datos, de tal
forma que no permita que estos sean alterados,
sin que quede el registro correspondiente. Debe
garantizar la trazabilidad de los datos.
Sobre el reporte, debe permitir un informe básico
y dar la opción al usuario de seleccionar la
información que requiere en el informe tal como:
Nombre y número de los picos, tiempo de
retención, áreas y alturas (en forma simultánea),
concentración, espectro en tres dimensiones,
datos espectrales, reporte de la pureza de los
picos, porcentaje de impurezas detectadas,
confirmación de la identificación de compuestos
con la librería o base de datos, platos teóricos de
columna, asimetría de picos, resolución.
Debe tener incorporado un tipo de reporte para la
validación de métodos.
Suministrar el programa de operación con su
respectiva licencia y un certificado de validación
del mismo.
Procesador de datos



Ordenador de marca reconocida (no clon).
Procesador 2.8 GHz o mejor.
Pantalla plana de 43 cm (17 pulg) o superior.
2013.1
c4f_annexiitechspeciiitechoffer_es
Página 98 de 213
1.
2.
3.
4.
5.
Número
del
artículo
Especificaciones requeridas
Especificaciones ofrecidas
Notas, observaciones,
referencia a la
documentación
Notas del Comité
de Evaluación







Memoria RAM de 2,0 GB o mejor.
Disco duro de 250 GB o superior
Unidad CD writer/DVD 52X o mejor.
Teclado en español y Mouse óptico.
Debe incluir sistema compatible con ambiente
Windows con sus respectivas licencias.
Debe incluir una impresora laser
Requerimiento eléctrico cromatógrafo: 110115V, 50/60. con conectores incluidos.
GARANTÍA:






12 meses de garantía como mínimo contra
defectos de manufactura y funcionamiento.
Durante el periodo de la garantía efectuar las
reparaciones, revisiones y sustitución de piezas
dañadas sin costo adicional.
Equipo completamente nuevo, fabricado con
materiales de primera calidad.
Garantía de repuestos de al menos 5 años,
después de descontinuada su fabricación.
Que tenga preferiblemente soporte técnico en el
país, inventario de repuestos básicos y personal
técnico capacitado.
Manual de usuario en idioma español de
preferencia.
INSTALACIÓN Y ENTRENAMIENTO:
 La instalación debe incluir la verificación
completa de funcionamiento con certificado
(OQ/PV). Instalación del mismo bajo el
procedimiento oficial del fabricante (IQ).
2013.1
c4f_annexiitechspeciiitechoffer_es
Página 99 de 213
1.
2.
3.
4.
5.
Número
del
artículo
Especificaciones requeridas
Especificaciones ofrecidas
Notas, observaciones,
referencia a la
documentación
Notas del Comité
de Evaluación
El equipo debe quedar completamente instalado y
funcionando con las aplicaciones del Laboratorio.

Entrenamiento de aproximadamente 2 semanas, al
personal designado por la institución para la
utilización del equipo, garantizando su total
manejo operativo, avalado por un certificado de la
Empresa.
 Deben suministrarse los manuales de operación y
mantenimiento de cada una de las partes del
equipo, en idioma español de preferencia.
 Debe incluirse el plan de mantenimiento
preventivo y la verificación que se dará al equipo
durante el periodo de garantía.
2013.1
c4f_annexiitechspeciiitechoffer_es
Página 100 de 213
1.
2.
3.
4.
5.
Número
del
artículo
Especificaciones requeridas
Especificaciones ofrecidas
Notas, observaciones,
referencia a la
documentación
Notas del Comité
de Evaluación
ACCESORIOS:



















Kit de herramientas del Sistema HPLC.
6 botellas de 1 litro para solvente.
4 unidades de sellos de piston.
4 unidades de filtros de entrada.
4 unidades de disfragma.
4 pistones.
4 sellos de oro.
1 cartucho para válvula activa.
Aceite para bomba mecánica
Soporte para válvula de purga.
1 Loop 20 µL , 1 de 50 µL
Kit de conectores biselados 1/8”.
1000 viales ámbar transparente con tapa ( tipo
rosca)
1000 septum TFE-Silicona
6 jeringas de 200 µL
Kit de repuestos básicos para el sistema inyector
y automuestreador.
Embolo para jeringa de 200 µL.
2 Columnas de 3 micrones C 18 50 X 2.00mm y
6 guardacolumnas.
2 columnas de 5 micrones C 18 50 x 200 mm y 6
guardacolumnas
2013.1
c4f_annexiitechspeciiitechoffer_es
Página 101 de 213
1.
2.
3.
4.
5.
Número
del
artículo
Especificaciones requeridas
Especificaciones ofrecidas
Notas, observaciones,
referencia a la
documentación
Notas del Comité
de Evaluación
11
CROMATOGRAFO DE GASES
Cantidad: Uno (1)
Horno:
 Capacidad de trabajo de temperatura ambiente +
4 a 450 ºC en incrementos de 1ºC.
 Debe permitir el uso de 6 rampas de temperatura
con posibilidad de calentamiento de hasta
120ºC/min.
 Capacidad para realizar compensación de línea
base.
 Con control electrónico de presión y flujo para
todos los gases en todos los módulos: puerto de
inyección, gas de arrastre y detector. Con
resolución de 0,001 psi.
 El control electrónico de presión y flujo debe
realizar la compensación automática por presión
atmosférica y temperatura ambiente y de trabajo,
en tiempo real.
 El control electrónico debe poseer la capacidad
de permitir el trabajo a flujo y presión constante.
 Debe permitir el trabajo con bloqueo de tiempos
de retención y su comparación con una biblioteca
de plaguicidas, para la normalización del
cromatograma.
 Opción de ahorro de gas.
 Debe poseer un autodiagnóstico al encenderse y
un autotest de fugas que se pueda realizar a
necesidad del usuario, para así asegurar el
correcto desempeño del equipo en el momento
que así se requiera.
2013.1
c4f_annexiitechspeciiitechoffer_es
Página 102 de 213
1.
2.
3.
4.
5.
Número
del
artículo
Especificaciones requeridas
Especificaciones ofrecidas
Notas, observaciones,
referencia a la
documentación
Notas del Comité
de Evaluación
 Debe tener seis zonas independientes de
calentamiento: 2 para los inyectores, 2 para los
detectores y 2 para los auxiliares.
 Debe poseer interfase LAN para control del
instrumento.
 Debe tener la capacidad de adquisición de datos
de los detectores hasta una frecuencia de 200 Hz.
 Con capacidad de uso de gases de arrastre y
makeup de helio, hidrógeno, nitrógeno y
metano/argón.
Puerto de inyección tipo split/splitless:
 Temperatura máxima de trabajo 400ºC.
 Control electrónico del gas de arrastre en todos
los flujos del puerto de inyección con un ámbito
de trabajo de 0 a 100 psi con una resolución de
0,001 psi.
 Ámbito de trabajo para los flujos de gases de 0 a
200 mL/min con hidrogeno y helio.
 El puerto de inyección debe de abrirse para
cambiar el septum sin necesidad de herramienta
 Split máximo de 7500 a 1.
 Con flujo de purga de septum de valor fijo.
Detector µECD:
 Con control electrónico de todos los gases con un
ámbito de trabajo de 0 a 100 psi con resolución
de 0,001 psi.
 Temperatura máxima de trabajo al menos de 400
ºC.
 Con límites de detección de < 6 fg/ml como
2013.1
c4f_annexiitechspeciiitechoffer_es
Página 103 de 213
1.
2.
3.
4.
5.
Número
del
artículo
Especificaciones requeridas
Especificaciones ofrecidas
Notas, observaciones,
referencia a la
documentación
Notas del Comité
de Evaluación
lindano con Detector a 300 0C y con flujo a
“make up” de 30 ml/min al Detector esto es
equivalente a 6 fg/sec.
 Compatible con columnas capilares.
Muestreador e inyector automático:
 Debe permitir seleccionar el tamaño de la
muestra, número de inyecciones, velocidad de la
inyección y debe permitir programar la inyección
automática de alta velocidad, lavado de la jeringa
con dos disolventes diferentes, profundidad
variable de muestreo de la aguja.
 Con capacidad de realizar de 1 a 90 inyecciones
aproximadamente de cada vial.
 La reproducibilidad para las áreas debe ser
menor o igual a 0.3% RSD.
 La reproducibilidad para los tiempos de retención
debe ser menor o igual a 0.1% RSD.
 La bandeja muestreadora debe tener capacidad al
menos para 100 viales de 2 mL.
 Todo el sistema automuestreador debe manejarse
y operarse desde el equipo y el programa de
operación del equipo.
Programa de operación:
 En idioma español que cumpla con una norma de
calidad (CFR parte 11) para asegurar que el
sistema trabaje aplicando las buenas prácticas de
laboratorio y cumpla con las normas
internacionales de calidad.
2013.1
c4f_annexiitechspeciiitechoffer_es
Página 104 de 213
1.
2.
3.
4.
5.
Número
del
artículo
Especificaciones requeridas
Especificaciones ofrecidas
Notas, observaciones,
referencia a la
documentación
Notas del Comité
de Evaluación
 Debe comunicarse por medio de tarjeta LAN con
el equipo.
 Debe permitir aplicaciones típicas en
cromatografía tales como: Desarrollo y
optimización de métodos, visualización de
cromatogramas en diferentes formas,
manipulación de cromatogramas para la
integración de las señales, identificación de
señales, como mínimo.
 Debe permitir el cálculo de un resultado final
sobre la base de curvas de calibración utilizando
estándar interno o externo.
En caso de cromatogramas con más de un pico de
interés, el sistema debe permitir el cálculo de
cada uno de los analitos de interés en forma
separada
 Debe permitir el cálculo de los parámetros para la
adecuación del sistema.
 Debe ser compatible con plataforma Windows.
 Se debe entregar un CD o disquetes de todo el
software necesario para la operación del equipo,
son sus respectivas licencias.
 El software debe poseer la capacidad de
autorango para la señal del detector.
 Debe permitir la generación de reportes en
formatos tipo texto, hoja de cálculo y hojas de
Internet (html).
 Debe permitir e manejo de un cromatógrafo de
gases adicional completo.
Procesador de datos:
 Procesador 2.8 GHz o mejor.
 Monitor a color de 43 cm (17 pulg), pantalla
LCD
2013.1
c4f_annexiitechspeciiitechoffer_es
Página 105 de 213
1.
2.
3.
4.
5.
Número
del
artículo
Especificaciones requeridas
Especificaciones ofrecidas
Notas, observaciones,
referencia a la
documentación
Notas del Comité
de Evaluación






Memoria RAM de 512 MB o mejor.
Disco duro de 80 GB o mejor.
Unidad de disco suave de 1.44 MB.
CD writer/DVD 52X o mejor.
Teclado y ratón ergonómicos.
Debe incluir plataforma compatible con
Windows con su respectiva licencia.
 Con sistema de impresión láser.
GARANTÍA:






12 meses de garantía como mínimo contra
defectos de manufactura y funcionamiento.
Durante el periodo de la garantía efectuar las
reparaciones, revisiones y sustitución de piezas
dañadas sin costo adicional.
Equipo elaborado con materiales de primera
calidad.
Garantía de repuestos de al menos 5 años,
después de descontinuada su fabricación.
De preferencia que tenga soporte técnico en el
país, inventario de repuestos básicos y personal
técnico capacitado.
Manual de usuario en idioma español de
preferencia.
INSTALACIÓN Y ENTRENAMIENTO:
 La instalación debe incluir la verificación
completa de funcionamiento con certificado
(OQ/PV). Instalación del mismo bajo el
procedimiento oficial del fabricante (IQ).
2013.1
c4f_annexiitechspeciiitechoffer_es
Página 106 de 213
1.
2.
3.
4.
5.
Número
del
artículo
Especificaciones requeridas
Especificaciones ofrecidas
Notas, observaciones,
referencia a la
documentación
Notas del Comité
de Evaluación
 La instalación debe incluir la verificación
completa de funcionamiento con certificado
(OQ/PV). Instalación del mismo bajo el
procedimiento oficial del fabricante (IQ).
El equipo debe quedar completamente instalado y
funcionando con las aplicaciones del Laboratorio.

Entrenamiento de aproximadamente 2 semanas, al
personal designado por la institución para la
utilización del equipo, garantizando su total
manejo operativo, avalado por un certificado de la
Empresa.
 Deben suministrarse los manuales de operación y
mantenimiento de cada una de las partes del
equipo, en idioma español de preferencia
 Debe incluirse el plan de mantenimiento
preventivo y la verificación que se dará al equipo
durante el periodo de garantía, para su evaluación
por parte del laboratorio.
 Todo el sistema debe tener un requerimiento
eléctrico de 110-120V, 50/60Hz. con conectores
incluidos
2013.1
c4f_annexiitechspeciiitechoffer_es
Página 107 de 213
1.
2.
3.
4.
5.
Número
del
artículo
Especificaciones requeridas
Especificaciones ofrecidas
Notas, observaciones,
referencia a la
documentación
Notas del Comité
de Evaluación
ACCESORIOS:
 El equipo debe venir equipado con 2 jeringas
para automuestreador compatibles con el sistema.
 2 liner split-splitless.
 1 columna no polar (HP-5MS o equivalente) de
 1 columna de polaridad intermedia (HP-50+ o
 1000 viales ámbar de 2 mL de rosca con septum
(con recubrimiento de PTFE), tapa para
automuestreador.
 2000 septum con recubrimiento de PTFE.
 1000 viales claros de 2 mL de rosca con septum
(con recubrimiento de PTFE), tapa para
automuestreador.
 Ferrulas de 85% Vespel ,15% grafito - 10/paq.
 Trampa de vidrio para humedad, 13X4A, 1/8”
250 cc.
 Clip para montar la trampa universal de 250cc.1
5/8-1 7/8” OD.
 Trampa de Humedad / O2,1/8”
 Clip para montar trampa de humedad / O2, 120200 cc
 Big Universal Trap; fittings de 1/8, Nitrogeno.
 Clip para montar Big Universal Trap ,2-2 1/ 2
“OD – 2 Paquetes.
 Regulador de presión CGA 350-125 psig max
(8.6 bar)-H2, Ar, N2.
 Regulador de dos etapas, CGA 580,125 psig max
(8.6 bar), He, Ar, N2.
 Syringe, 10 ul tapered.
 Tubería de cobre, 1/8”,50’.
2013.1
c4f_annexiitechspeciiitechoffer_es
Página 108 de 213
1.
2.
3.
4.
5.
Número
del
artículo
Especificaciones requeridas
Especificaciones ofrecidas
Notas, observaciones,
referencia a la
documentación
Notas del Comité
de Evaluación
 Kit de mantenimiento con todas las herramientas
y consumibles para realizar el mantenimiento por
año, indicar el contenido de dicho kit.
 Herramienta corta-columnas GC con diamante
giratorio y cuchilla de diamante de respuesto
 Herramienta selladora de 11 mm.
 Herramienta deselladora de 11 mm
2013.1
c4f_annexiitechspeciiitechoffer_es
Página 109 de 213
1.
2.
3.
4.
5.
Número
del
artículo
Especificaciones requeridas
Especificaciones ofrecidas
Notas, observaciones,
referencia a la
documentación
Notas del Comité
de Evaluación
12
Analizador de mercurio
Cantidad: Uno (1)

Para análisis de muestras sólidas y
liquidas

Sistema de medida de tres celdas y
doble paso de luz (path), ajustable para el
tratamiento de muestra en tiempo y temperatura

Incluir terminal con ratón, teclado,
tarjeta memoria, cable conectores de 12” como
mínimo, pantalla a colores de alta resolución,
pantalla digital suplido con tablero y ratón con
resolución VGA 800x600.

Para muestras sólidas y liquidas
debe de ser 1.5 g/ml máximo

Carta memoria compatible con
plataforma Windows removible para guardados
automáticos de métodos y datos, con interfase
para impresora.

Software compatible en plataforma
Windows para transferencia de datos

Incluir espectrofotómetro de un
rayo, con flujo secuencial a través de las medidas
en las celdas

Lámpara de mercurio de baja
presión, longitud de onda: 253.65 nm

Filtro de interferencia: 254 nm, 9
mm de ancho de banda

Fotodiodos de ultravioleta

Limite de detección para solidos y
líquidos: 0.0015 ng
 Rango de trabajo (automatico) para solidos y
líquidos, Rango bajo: 0-10 ng, rango alto: 201200 ng, rango medio: 10-20 ng
2013.1
c4f_annexiitechspeciiitechoffer_es
Página 110 de 213
1.
2.
3.
4.
5.
Número
del
artículo
Especificaciones requeridas
Especificaciones ofrecidas
Notas, observaciones,
referencia a la
documentación
Notas del Comité
de Evaluación








Precisión típica: menos que 1.5%
Calibración: soluciones estándar de materiales de
referencia certificados
Compresor de aire u oxigeno
Automuestreador 40 lugares, con opción de
bandeja
Software compatible en plataforma Windows con
documentación para BPL (GLP) y Normas ISO
Trasferencia de peso automatico con interfase e
incluida la balanza externa
Dimensions cm 35 x 25 x 7h (14"x10"x3")
Potencia: 110V/50Hz-60Hz
GARANTÍA:





El equipo será instalado en Laboratorio FísicoQuímico de Alimentos y Nutrición CNDRMINSA y se deberá demostrar su funcionamiento
correcto con muestras de interés para el
laboratorio.
Impartir capacitación teórica y práctica al
personal seleccionado, por un período de 7 días
sobre manejo y mantenimiento preventivo del
equipo y las aplicaciones analíticas de interés,
proporcionando el certificado correspondiente al
finalizar el curso.
12 meses de garantía como mínimo contra
defectos de manufactura y funcionamiento.
Durante el periodo de la garantía efectuar las
reparaciones, revisiones y sustitución de piezas
dañadas sin costo adicional.
Equipo completamente nuevo, fabricado con
materiales de primera calidad.
Garantía de repuestos de al menos 5 años,
después de descontinuada su fabricación.
2013.1
c4f_annexiitechspeciiitechoffer_es
Página 111 de 213
1.
2.
3.
4.
5.
Número
del
artículo
Especificaciones requeridas
Especificaciones ofrecidas
Notas, observaciones,
referencia a la
documentación
Notas del Comité
de Evaluación

13
Manual de usuario preferiblemente en idioma
español.
Estación de parafina (EC350 paquete Cryo y
consola dispensadora)
Cantidad: Uno (1)
 Formato modular que proporciona flexibilidad y
ahorro de espacio.
 Con depósito para 5 litros de parafina,
dispensador de calefacción, superficie de trabajo
climatizada, incluye compartimientos separados
con calefacción para moldes y casetes.
 Cuenta con una superficie de trabajo grande
antiadherente para los bloques de parafina y
refrigeración integrada.
 La temperatura puede ser controlada de 0o a 15oC
 La unidad cuenta con tiempos programables de
operacion incluyendo el arranque automatico
 La superficie caliente se controla de forma
independiente y el rango de temperatura va desde
50o hasta 75oC.
Dimensiones:


Consola: 25 1/2D x 23 1/2 x 17” (650 x 595 x
430 mm.)
Cryo: 23 ½ x 13 3/8 x 16” (600 x 340 x 405mm)
Requerimientos eléctricos: 110/120V 50/60Hz
2013.1
c4f_annexiitechspeciiitechoffer_es
Página 112 de 213
1.
2.
3.
4.
5.
Número
del
artículo
Especificaciones requeridas
Especificaciones ofrecidas
Notas, observaciones,
referencia a la
documentación
Notas del Comité
de Evaluación
GARANTÍA:






1 año de garantía como mínimo, contra defectos
de manufactura y funcionamiento. Durante el
periodo de la garantía, efectuar las reparaciones,
revisiones y sustitución de piezas dañadas sin
costo adicional.
Equipo completamente nuevo, fabricado con
materiales de primera calidad,
Manual de usuario en idioma español
preferiblemente.
La instalación debe incluir la verificación
completa de funcionamiento con certificado
(OQ/PV). Instalación del mismo bajo el
procedimiento oficial del fabricante (IQ).
El adjudicatario dará entrenamiento al personal
designado por la institución en la operación del
equipo. El entrenamiento debe ser impartido por
un experto en el tema. Garantía de repuestos de al
menos 5 años, después de descontinuada su
fabricación.
De preferencia que tenga soporte técnico en el
país, inventario de repuestos básicos y personal
técnico capacitado.
2013.1
c4f_annexiitechspeciiitechoffer_es
Página 113 de 213
1.
2.
3.
4.
5.
Número
del
artículo
Especificaciones requeridas
Especificaciones ofrecidas
Notas, observaciones,
referencia a la
documentación
Notas del Comité
de Evaluación
14
Procesador de tejidos
Cantidad: Uno (1)
 Procesador de tejidos de mesa, equipo compacto
y semi-cerrado, diseñado para procesar muestras
biológicas por fijación química para la
infiltración de parafina. El diseño único emplea
fuerza centrífuga programable suave para
aumentar el proceso normal de agitación vertical
asociada con los procesadores de carrusel.
 EL arrastre de reactivo se reduce a través de los
giros de la cesta de casete encima del recipiente
del reactivo.
 El carbón vegetal mejora el sistema de
ventilación en la parte superior del recipiente de
reactivos y ayuda al de control del proceso.
 El microprocesador debe poder mantener hasta
10 programas de procesamiento diferentes.
 Los modos de procesamiento incluyen la puesta
en marcha inmediata y tardía, y el tiempo de
inmersión en cada estación se puede ajustar desde
un minuto hasta 99 horas y 59 minutos.
 Las cestas de casetes deben girar en sentido
horario y antihorario dentro del contenedor de
reactivo para mejorar el procesamiento de las
muestras
 Cada uno de canasta casetes deben contener hasta
120 casetes.
 El procesador de tejidos debe contar con un
sistema de batería de respaldo en caso de fallo de
la energía eléctrica.
2013.1
c4f_annexiitechspeciiitechoffer_es
Página 114 de 213
1.
2.
3.
4.
5.
Número
del
artículo
Especificaciones requeridas
Especificaciones ofrecidas
Notas, observaciones,
referencia a la
documentación
Notas del Comité
de Evaluación
GARANTÍA:



1 año de garantía como mínimo contra defectos
de manufactura y funcionamiento, durante el
periodo de la garantía, se deben efectuar las
reparaciones, revisiones y sustitución de piezas
dañadas sin costo adicional.
Equipo completamente nuevo, fabricado con
materiales de primera calidad,
Manual de usuario en idioma español
preferiblemente.
INSTALACIÓN Y ENTRENAMIENTO:
 El equipo será instalado en Laboratorio de
diagnóstico veterinario y microbiología de
alimentos
 La instalación debe incluir la verificación
completa de funcionamiento con certificado
(OQ/PV). Instalación del mismo bajo el
procedimiento oficial del fabricante (IQ).
 Entrenamiento de aproximadamente 2 semanas, al
personal designado por la institución para la
utilización del equipo, garantizando su total
manejo operativo, avalado por un certificado de la
Empresa.
 El entrenamiento debe ser impartido por un
experto en el tema
 Requerimiento eléctrico: 110/115v 50/60 hz.
15
Criostato
2013.1
c4f_annexiitechspeciiitechoffer_es
Página 115 de 213
1.
2.
3.
4.
5.
Número
del
artículo
Especificaciones requeridas
Especificaciones ofrecidas
Notas, observaciones,
referencia a la
documentación
Notas del Comité
de Evaluación
Cantidad: Uno (1)
Cryostato versátil y de alta calidad diseñado para
aplicaciones clínicas o de investigación








Tamaño máximo de muestra de 70 x 55 mm.
Rango de espesor 1 a 100 µm.
Grosor de corte de 5 a 500 µm.
Desplazamiento vertical de 60 mm
Movimiento horizontal máxima de 28 mm.
Cámara de enfriamiento rango de 0 a-35oC.
Peso 125 a 155 kg
Requerimiento eléctrico: 110 120v, 60Hz,
12A+10%
 Dimensiones: 30 x 25 x 47” (76 x 64 x 120cm)
 Requerimiento eléctrico de 110-120V, 50/60Hz.
Incluye:
 3 platinas para muestras (2) de 30mm y (1) de
40mm;
 2 oz. neg-50; 100 ml de aceite para Criostato;
 bandeja de instrumentos;
 cepillos (2);
 herramientas.
GARANTÍA:
 1 año de garantía como mínimo contra defectos
de manufactura y funcionamiento. Durante el
periodo de la garantía efectuar las reparaciones,
revisiones y sustitución de piezas dañadas sin
costo adicional
2013.1
c4f_annexiitechspeciiitechoffer_es
Página 116 de 213
1.
2.
3.
4.
5.
Número
del
artículo
Especificaciones requeridas
Especificaciones ofrecidas
Notas, observaciones,
referencia a la
documentación
Notas del Comité
de Evaluación
 Equipo fabricado con materiales de primera
calidad.
 Garantía de repuestos de al menos 5 años,
después de descontinuada su fabricación.
 De preferencia que tenga soporte técnico en el
país, inventario de repuestos básicos y personal
técnico capacitado
INSTALACIÓN Y ENTRENAMIENTO:
 El equipo será instalado en Laboratorio Central
de diagnóstico veterinario y microbiología de
alimentos
 La instalación incluye la verificación de
funcionamiento con certificado (CSA).
Instalación bajo procedimiento oficial del
fabricante.

Entrenamiento de aproximadamente 2 semanas, al
personal designado por la institución para la
utilización del equipo, garantizando su total
manejo operativo, avalado por un certificado de la
Empresa.

 El entrenamiento debe ser impartido por un
experto en el tema.
 Manuales de operación y mantenimiento de cada
una de las partes del equipo, en idioma español
preferiblemente.
 Plan de mantenimiento verificación que se dará
al equipo durante el periodo de garantía.
2013.1
c4f_annexiitechspeciiitechoffer_es
Página 117 de 213
1.
2.
3.
4.
5.
Número
del
artículo
Especificaciones requeridas
Especificaciones ofrecidas
Notas, observaciones,
referencia a la
documentación
Notas del Comité
de Evaluación
LOTE 5 – EQUIPOS AUXILIARES PARA ANALISIS DE LABORATORIO
1
HORNO
Cantidad: uno (1)
 Force air oven. Cámara interior de acero
inoxidable 46 x 46 x67 cm.
 Rango de temp 50° a 275 °C.
 Control digital de temperatura variable.
 Protección automatica de temperatura y alarma
visual
2
Baños Ultrasónicos 20.8 L
Cantidad: dos (2)
 Control mecánico y calentador. Dimensiones
45.7 x 60.9 x 36.8 cm. 110 V
3
Baño Ultrasónico para lavado de pipetas.
Cantidad: uno (1)
 Con calentador, canasta para pipetas y tapadera.
 Dimensiones del tanque 14.6 x 49.5 x 15.2 cm.
2013.1
c4f_annexiitechspeciiitechoffer_es
Página 118 de 213
1.
2.
3.
4.
5.
Número
del
artículo
Especificaciones requeridas
Especificaciones ofrecidas
Notas, observaciones,
referencia a la
documentación
Notas del Comité
de Evaluación
4
Platos calentadores.
Cantidad: dos (2)
 Con superficie de porcelana de 12 ½ x 12 ½
pulgadas.
 Control de temperatura variable y agitador
5
Sistema de Evaporación Turbo Vap LV
Cantidad: uno (1)
 5 líneas de distribución de Nitrógeno con control
individual para cada una de ellas.
 Control ajustable de nitrógeno.
 Control de temperatura y del tiempo.
 Con 2 Gradillas para 50 tubos de 30 mL
 Con 2 Gradillas para 50 tubos de centrífuga de 15
ml.
2013.1
c4f_annexiitechspeciiitechoffer_es
Página 119 de 213
1.
2.
3.
4.
5.
Número
del
artículo
Especificaciones requeridas
Especificaciones ofrecidas
Notas, observaciones,
referencia a la
documentación
Notas del Comité
de Evaluación
6
Gabinete de seguridad Biológica clase II
Cantidad: Uno (1)
 Velocidad de entrada nominal debe ser igual o
mayor de 105 pies por minuto(≥0,5m/ seg)
 La recirculación de aire debe ser mayor del 60 %.
 Monitor de LCD que exprese vida útil de los
filtros.
 Control de pantalla táctil para la activación
manual del ventilador, luz, cronómetro, alarma
audible y la selección del menú.
 Interior de acero inoxidable, desmontable,
revestimiento epóxico exterior de acero.
 Cumplimiento de las condiciones clases 5 por la
norma ISO 14644-1 y 2, filtros HEPA 99,99%.
 Mecanismo anti-trasiego y 10 grados de
inclinación; altura máxima de la apertura (entre
52 y 56 cm), parrilla curvada de acero inoxidable
con entrada secundaria de aire.
 Rango de ancho nominal: 5 pies
 Rango de apertura de banda: 7 a 9 pulgadas
 Requerimiento eléctrico:115-120 voltios, 50/60
Hz
 Iluminación:ultravioleta y lámpara fluorescente
 Incluye base que soporte cargas de hasta 1000
libras y marco de acero revestido de epoxi
 GARANTÍA: 12 meses de garantía como
minimo contra defecto de manufactura y mal
funcionamiento.
2013.1
c4f_annexiitechspeciiitechoffer_es
Página 120 de 213
1.
2.
3.
4.
5.
Número
del
artículo
Especificaciones requeridas
Especificaciones ofrecidas
Notas, observaciones,
referencia a la
documentación
Notas del Comité
de Evaluación
7
Base para Gabinete de seguridad Biológica clase II
Cantidad: Uno (1)
 Soporte telescópica con patas fijas. Los soporte
debe tener patillas desmontable, para ajustar las
patas en ocho alturas diferentes en incrementos
de 1 pulgada de 27,5 pulgadas a 34,5 pulgadas.
 Debe soportar cargas de hasta 1000 libras, marco
de acero revestido de epoxi.
 Dimensiones del artículo: 50.5 pulgadas de ancho
x 29.0 pulgadas de profundidad
 Ancho nominal: 4 pies
2013.1
c4f_annexiitechspeciiitechoffer_es
Página 121 de 213
1.
2.
3.
4.
5.
Número
del
artículo
Especificaciones requeridas
Especificaciones ofrecidas
Notas, observaciones,
referencia a la
documentación
Notas del Comité
de Evaluación
8
Ultracongelador vertical para almacenamiento de
material biológico
Cantidad: Uno (1)









Rango de temperatura: -86 ° a -50 ° C
Rango de Capacidad: 12 a 15 pies cúbicos
Descongelación manual
Sistema de Monitoreo de alarma
La puerta debe ser de alta densidad de fácil
acceso, con aislamiento integrado y llave de
bloqueo de seguridad.
Cuatro estantes de acero inoxidable interior
Cinco puertas de plástico en el interior para
reducir la exposición cuando se abra.
Con capacidad para guardar de 200 a 300
cajas de viales.
Requerimiento eléctrico: 115-120 voltios,
50/60 Hz
GARANTÍA:

12 meses de garantía como minimo contra
defecto de manufactura y mal
funcionamiento.
2013.1
c4f_annexiitechspeciiitechoffer_es
Página 122 de 213
1.
2.
3.
4.
5.
Número
del
artículo
Especificaciones requeridas
Especificaciones ofrecidas
Notas, observaciones,
referencia a la
documentación
Notas del Comité
de Evaluación
9
Set de pesas certificadas ultra clase de 1 mg hasta
200 g
Cantidad: Uno (1)




Set de pesas de precisión de ultra clase.
Certificación: Declaración de precisión.
Configuración del set de pesas: 200 g, 100 g,
50 g, 20 g, 10 g, 5 g, 2 g, 1 g, 500 mg, 200
mg, 100 mg, 50 mg, 20 mg, 10 mg, 5 mg, 2
mg, 1 mg.
Caja: debe ser de Polypropyleno con
compartimientos individuales a cada peso y
debe incluir una pinza.
GARANTÍA:

12 meses de garantía como minimo contra
defecto de manufactura y mal
funcionamiento.
2013.1
c4f_annexiitechspeciiitechoffer_es
Página 123 de 213
1.
2.
3.
4.
5.
Número
del
artículo
Especificaciones requeridas
Especificaciones ofrecidas
Notas, observaciones,
referencia a la
documentación
Notas del Comité
de Evaluación
10
Baño de circulación de agua con agitación recíproca
y orbital
Cantidad: Uno (1)











Baño de circulación de agua diseñado para un
amplio rango de temperatura controlada y
agitación recíproca y orbital
Rango de capacidad: 7 a 8 galones
Rango de temperatura: 5° C hasta 99 ° C.
Estabilidad y uniformidad de temperatura
menor de 0.2 °C.
Velocidad ajustable de 20 to 200 rpm, 1 rpm
en incremento.
Radio orbital de 10 mm
Longitud lineal del trazo de 20 mm.
Puerto de dreno con desconexión rápida
Tapa de policarbonato
Requerimiento eléctrico: 115-120 voltios,
50/60 Hz
Debe incluir bandeja universal para frascos de
25 ml.
GARANTÍA:

12 meses de garantía como minimo contra
defecto de manufactura y mal funcionamiento.
2013.1
c4f_annexiitechspeciiitechoffer_es
Página 124 de 213
1.
2.
3.
4.
5.
Número
del
artículo
Especificaciones requeridas
Especificaciones ofrecidas
Notas, observaciones,
referencia a la
documentación
Notas del Comité
de Evaluación
11
Microcentrifuga compacta con rotor de 12 viales
de 1.5/2.0 ml
Cantidad: Dos (2)











Microcentrífuga compacta.
Rotor con capacidad de 12 viales de 1.5/2.0
ml
Capacidad de giro rcf de 14,000 g
Desaceleración y aceleración menor de 15
seg.
Pantalla digital del tiempo y velocidad.
Rotor metálico.
Botón separado para un corto giro de
centrifugación rápida.
Tapa de la centrifuga resistente a químicos.
Velocidad 800-14,000 rpm
Pantalla de velocidad en rpm y rcf.
Requerimiento eléctrico: 115-120 voltios,
50/60 Hz.
GARANTÍA:

12 meses de garantía como minimo contra
defecto de manufactura y mal funcionamiento.
2013.1
c4f_annexiitechspeciiitechoffer_es
Página 125 de 213
1.
2.
3.
4.
5.
Número
del
artículo
Especificaciones requeridas
Especificaciones ofrecidas
Notas, observaciones,
referencia a la
documentación
Notas del Comité
de Evaluación
12
Microcentrífuga con rotor de 24 viales de 1.5/2.0 ml
Cantidad: uno (1)












Capacidad del rotor de 24 x 1.5 ml/2.0 ml
Capacidad máxima RCF: 21,130 x g
Capacidad Máxima RPM: 15,000 rpm
Tiempo de aceleración menor de 16 seg.
Tiempo de frenado menor de 18 seg.
Giro rápido para corridas rápidas.
Pantalla digital completa del tiempo y la
velocidad.
Niveles de sonido menor de 55 dB.
Panel de control: en forma de perilla.
Bóveda del rotor metálica y de fácil limpieza.
Debe incluir rotor de 24 x 1.5 ml/2.0 ml
Requerimiento eléctrico: 115-120 voltios,
50/60 Hz.
GARANTÍA:

12 meses de garantía como minimo contra
defecto de manufactura y mal funcionamiento.
2013.1
c4f_annexiitechspeciiitechoffer_es
Página 126 de 213
1.
2.
3.
4.
5.
Número
del
artículo
Especificaciones requeridas
Especificaciones ofrecidas
Notas, observaciones,
referencia a la
documentación
Notas del Comité
de Evaluación
13
Mezclador térmico de bloque seco
Cantidad: Uno (1)









Sistema de calentamiento peltier.
Rango de control de temperatura: 13C ° hasta
99 °C
Frecuencia de mezcla: 300-1,500 rpm
Precisión de incubación: menor 0.6 °C
Velocidad de calentamiento: Menor de
6°C/min.
Velocidad de enfriamiento: Menor de 4
°C/min
Mezcla orbital: 3 mm
Requerimiento eléctrico: 115-120 voltios,
50/60 Hz
Debe incluir los siguientes bloques:
1 Termobloque intercambiable para 24
microtubos (viales) de 1.5 ml con bandeja
isotérmica mas un paquete de enfriamiento
isotérmico.1 Termobloque intercambiable
para 8 tubos falcón de 15 ml.
GARANTÍA:

12 meses de garantía como minimo contra
defecto de manufactura y mal
funcionamiento.
2013.1
c4f_annexiitechspeciiitechoffer_es
Página 127 de 213
1.
2.
3.
4.
5.
Número
del
artículo
Especificaciones requeridas
Especificaciones ofrecidas
Notas, observaciones,
referencia a la
documentación
Notas del Comité
de Evaluación
14
Balanza electrónica de precisión (0.001 g a 320 g)
Cantidad: Uno (1)







Balanza analítica de alta resolución y
precisión, construida de aluminio y
suministrada con cobertura de protección
transparente. El sartén de pesado debe estar
construido de cromo-níquel, protección contra
el polvo y el agua
Capacidad: Hasta 320 g
Linealidad: Menor de 0.002 g
Legibilidad: 1 mg
Repetibilidad: 1 mg
Tiempo de estabilización 1.5 seg
Requerimiento eléctrico: 115-120 voltios,
50/60 Hz
GARANTÍA:

12 meses de garantía como minimo contra
defecto de manufactura y mal
funcionamiento.
2013.1
c4f_annexiitechspeciiitechoffer_es
Página 128 de 213
1.
2.
3.
4.
5.
Número
del
artículo
Especificaciones requeridas
Especificaciones ofrecidas
Notas, observaciones,
referencia a la
documentación
Notas del Comité
de Evaluación
15
Baño digital de circulación de agua
Cantidad: Dos (2)









Baño digital de alto rendimiento con tapa de
acero inoxidable.
Uniformidad de temperatura: menor de 0.6°C.
Set de temperatura en incremento de 0.1°C.
Control de microprocesador con pantalla
digital LED.
Rango de Capacidad 4.5 a 5.5 gal.
Rango de temperatura: 5°C hasta 99.9 °C.
Cámara de acero inoxidable
Requerimiento eléctrico: 115-120 voltios,
50/60 Hz.
GARANTÍA:

12 meses de garantía como minimo contra
defecto de manufactura y mal
funcionamiento.
2013.1
c4f_annexiitechspeciiitechoffer_es
Página 129 de 213
1.
2.
3.
4.
5.
Número
del
artículo
Especificaciones requeridas
Especificaciones ofrecidas
Notas, observaciones,
referencia a la
documentación
Notas del Comité
de Evaluación
16
Microscopio vertical con cámara digital
Cantidad: Uno (1)





Microscopio vertical
Objetivos plan acromaticos: 4X , 10X, 40X,
100X aceite de inmersión.
Binocular de 10 X de campo amplio,
especificación según norma DIN
Requerimiento eléctrico: 110-120 voltios,
50/60 Hz
Cámara digital: Resolución mayor de 5
megapixeles, USB 2.0, compatible con
plataforma Windows, Software para capturar
imágenes, dimensión de 23 mm para calzar en
ocular del microscopio.
GARANTÍA:

12 meses de garantía como minimo contra
defecto de manufactura y mal
funcionamiento.
2013.1
c4f_annexiitechspeciiitechoffer_es
Página 130 de 213
1.
2.
3.
4.
5.
Número
del
artículo
Especificaciones requeridas
Especificaciones ofrecidas
Notas, observaciones,
referencia a la
documentación
Notas del Comité
de Evaluación
17
Centrifuga que incluya rotor y adaptador de tubos
de 50 ml
Cantidad: Uno (1)








Centrifuga de mesa: compacta, confortable y
de propósitos generales.
Control por microprocesador.
Pantalla LCD
Capacidad de 400 ml (8 tubos de 50 ml)
Máxima velocidad de 8500 rpm
Máxima RCF: 4675 x g
Requerimiento eléctrico: 115-120 voltios,
50/60 Hz
Debe incluir Rotor y adaptador de tubo falcón
de 50 ml
GARANTÍA:

12 meses de garantía como minimo contra
defecto de manufactura y mal funcionamiento.
2013.1
c4f_annexiitechspeciiitechoffer_es
Página 131 de 213
1.
2.
3.
4.
5.
Número
del
artículo
Especificaciones requeridas
Especificaciones ofrecidas
Notas, observaciones,
referencia a la
documentación
Notas del Comité
de Evaluación
18
Balanzas portátiles (0-600 g)
Cantidad: Tres (3)






Balanza portátil de fácil uso, pantalla LCD,
unidades de medida múltiple
Construcción del sartén de acero inoxidable.
Operación: AC adaptador o 4 baterías AA
Capacidad: 600 g
Legibilidad: 0.01 g
Plataforma: 120 mm
GARANTÍA:

12 meses de garantía como minimo contra
defecto de manufactura y mal
funcionamiento.
2013.1
c4f_annexiitechspeciiitechoffer_es
Página 132 de 213
1.
2.
3.
4.
5.
Número
del
artículo
Especificaciones requeridas
Especificaciones ofrecidas
Notas, observaciones,
referencia a la
documentación
Notas del Comité
de Evaluación
19
UPS inteligentes (Deben estar entre el Rango de
2000 a 3000 VA)
Cantidad: Tres (3)











Rango de potencia de salida debe estar entre
2000 a 3000 VA
Voltaje de salida nominal: 120 V
Distorsión de voltaje de salida: menor del 5 %
Frecuencia de salida: 50/60 Hz
Voltaje de entrada nominal: 120 V
Rango de voltaje de entrada para las
principales operaciones: 90-150 V
Frecuencia de entrada: 50/60 Hz
Batería de plomo-acido con electrólitos
suspendidos, a prueba de fuga.
Módulos de baterías incluidos: 1
Tiempo de recarga: 3 horas.
Debe incluir CD con software,
documentación del Cd, guía de instalación,
cable RS-232, USB cable.
GARANTÍA:

12 meses de garantía como minimo contra
defecto de manufactura y mal
funcionamiento.
2013.1
c4f_annexiitechspeciiitechoffer_es
Página 133 de 213
1.
2.
3.
4.
5.
Número
del
artículo
Especificaciones requeridas
Especificaciones ofrecidas
Notas, observaciones,
referencia a la
documentación
Notas del Comité
de Evaluación
20
UPS inteligentes (Deben estar entre el Rango de 600
a 800 VA).
Cantidad: Cinco (5)








Rango de capacidad de potencia de salida
debe estar entre 600 a 800 VA
Voltaje de salida nominal: 120 V
Distorsión de voltaje de salida: menos del 5 %
con carga total
Voltaje de entrada nominal: 120 V
Frecuencia de entrada: 50/60 Hz
Batería de plomo-acido con electrolitos
suspendidos, a prueba de fuga.
Tiempo de recarga: 5 horas.
Incluye: CD con software, documentación del
Cd, guía de instalación, cable RS-232, USB
cable.
GARANTÍA:
12 meses de garantía como minimo contra defecto de
manufactura y mal funcionamiento
2013.1
c4f_annexiitechspeciiitechoffer_es
Página 134 de 213
1.
2.
3.
4.
5.
Número
del
artículo
Especificaciones requeridas
Especificaciones ofrecidas
Notas, observaciones,
referencia a la
documentación
Notas del Comité
de Evaluación
21
Microcentrifuga con refrigeración
Cantidad: Uno (1)











Capacidad del rotor de 24 x 1.5 ml/2.0 ml
Maxima RCF: 21,130 x g
Maxima RPM: 15,000 rpm
Tiempo de aceleracion de 15 seg.
Tiempo de frenado de 16 seg.
Giro rápido para corridas rápidas.
Pantalla digital completa del tiempo y la
velocidad.
Panel de control: en forma de perilla.
Rango de temperatura: –10°C to 40°C, debe
Mantener constante los 4°C a máxima
velocidad
Debe incluir rotor de 24 x 1.5 ml/2.0 ml
Requerimiento eléctrico: 115-120 voltios,
50/60 Hz.
GARANTÍA:

12 meses de garantía como minimo contra
defecto de manufactura y mal funcionamiento.
2013.1
c4f_annexiitechspeciiitechoffer_es
Página 135 de 213
1.
2.
3.
4.
5.
Número
del
artículo
Especificaciones requeridas
Especificaciones ofrecidas
Notas, observaciones,
referencia a la
documentación
Notas del Comité
de Evaluación
22
Autoclave de sobremesa Clase B
Cantidad: Uno (1)








Capacidad 18 litros.
Cámara interior de acero inoxidable.
Urgado por vacío fraccionado.
Secado por vacío.
Dispositivo bloqueo de puerta para prevenir
aperturas accidentales.
Válvula de seguridad previene que la presión
sobrepase el límite máximo. Termostato de
seguridad que desconecta la calefacción en
caso de sobre temperatura o falta de agua en
el depósito.
Envolvente de protección térmica de la tapa
Requerimiento eléctrico: entre 115-120V
GARANTIA:
12 meses de garantía como mínimo contra defecto de
manufactura y mal funcionamiento.
2013.1
c4f_annexiitechspeciiitechoffer_es
Página 136 de 213
1.
2.
3.
4.
5.
Número
del
artículo
Especificaciones requeridas
Especificaciones ofrecidas
Notas, observaciones,
referencia a la
documentación
Notas del Comité
de Evaluación
23
Registradores electrónicos de temperatura
Cantidad: Veinte (20)









Deben ser capaz de medir y almacenar la
temperatura durante un tiempo y frecuencia
establecidos por el usuario. Los datos deberán
transferirse al ordenador mediante cable USB
para un posterior análisis.
Los sensores de temperatura deben tener
pantalla LCD y las sondas deben tener al
menos 0.5 metros de largo.
Rango de temperatura: - 40 a + 125 oC
Resolución de 0.1 oC
Precisión +/- 0.5 oC
Memoria de almacenaje no menor de 3500
lecturas
Muestreo: 0,1 a 255 minutos
Batería 3.6 voltios 1/2 AA con una vida no
menor de 1 año
Peso debe ser menor de 110 g
Nota: Deben incluir cable USB y software para
analizar la temperatura almacenada.
2013.1
c4f_annexiitechspeciiitechoffer_es
Página 137 de 213
1.
2.
3.
4.
5.
Número
del
artículo
Especificaciones requeridas
Especificaciones ofrecidas
Notas, observaciones,
referencia a la
documentación
Notas del Comité
de Evaluación
24
Homogeneizador de paletas
Cantidad: Uno (1)








Capacidad entre 80 y 400 ml
Que permita mezclas y homogenización
rápidas
Controlado por un microporcesador y lectura
digital de tiempo y velocidad
Rango de velocidad de 75 a 300 r.p.m.
(revoluciones por minuto)
3 Velocidades seleccionables a 200, 230 ó
260 r.p.m.
Tiempo programable entre 1 seg. 99 min. y 59
seg.
- Memoria para almacenar 3 combinaciones
de velocidad y tiempo.
Auto-funcionamiento por memoria repetitiva
mediante apertura y cierre de la puerta. Cierre
de la puerta con doble efecto.
Medidas cm: alto 28 x ancho 35 x fondo 34.
GARANTIA:
12 meses de garantía como mínimo contra defecto de
manufactura y mal funcionamiento.115-120 voltios
2013.1
c4f_annexiitechspeciiitechoffer_es
Página 138 de 213
1.
2.
3.
4.
5.
Número
del
artículo
Especificaciones requeridas
Especificaciones ofrecidas
Notas, observaciones,
referencia a la
documentación
Notas del Comité
de Evaluación
25
Agitador de tubos de laboratorio tipo vortex
Cantidad: Dos (2)






200 - 2500 rpm
Modo intermitente o continua
Modo touch
Diámetro orbital 4.2 mm
Dimensiones ancho, diámetro alto
135x215x78 mm
Peso 3.2 kg
GARANTIA:
12 meses de garantía como mínimo contra defecto de
manufactura y mal funcionamiento.115-120 voltios
26
Diluidor gravimétrico
Cantidad: Uno (1)








Doble bomba de dispensación
Tiempo de dilución menor de 20 segundos
para 250 ml
Factor de dilución 1/2 a 1/999
Precisión Menor de 0,05g peso muestra
Suministro eléctrico 110 voltios
Depósito de 5 litros botella autoclavable
Impresora
Lector código de barra
2013.1
c4f_annexiitechspeciiitechoffer_es
Página 139 de 213
1.
2.
3.
4.
5.
Número
del
artículo
Especificaciones requeridas
Especificaciones ofrecidas
Notas, observaciones,
referencia a la
documentación
Notas del Comité
de Evaluación
27
Medidor de densidad celular
Cantidad: Dos (2)



Medida rápida del crecimiento bacteriano
Memoria para 99 medidas
Soporte para cubeta 10 x 10 mm o tubo de
diámetro 16 mm
Alimentación 115V o por batería interna recargable
GARANTIA: 1 año
28
Carro de laboratorio de acero inoxidable
Cantidad: dos (2)


29
Capacidad de carga: 400 libras;
Dimensiones: 19-1/8L x 36-3/8 x 34-7/8W
in.H
Kit de pHTrazabilidad
metro
con
Certificado
de
Canitdad: uno (1)

Requerimiento eléctrico : 110 V 50/60Hz
Modo pH



Rango de pH -1.999 a +19.999pH
Resolución 0.1/0.01/0.001pH
Precisión Relativa +0.002pH +con un
digito menos significativo.
2013.1
c4f_annexiitechspeciiitechoffer_es
Página 140 de 213
1.
2.
3.
4.
5.
Número
del
artículo
Especificaciones requeridas
Especificaciones ofrecidas
Notas, observaciones,
referencia a la
documentación
Notas del Comité
de Evaluación
30
Cepa de referencia internacional
Cantidad: una (1)
Escherichia coli
Debe presentar genes para producir enterotoxinas estables ST
y labiles LT.
Tómese como referencia
ATCC 35401
NCTC 11602
CECT 685
31
Cepa de referencia internacional
Cantidad: una (1)
Escherichia coli
Debe presentar genes para producir Shiga-like toxin I y II or
verotoxinas VT1 y VT2.Serotipo O157:H7
Tómese como referencia
CECT 4783
32
Cepa de referencia internacional
Cantidad: una (1)
Escherichia coli
No debe presentar genes para producir Shiga-like toxin I y II
or verotoxinas VT1 y VT2.Serotipo O157:H7
No toxigenica
Tómese como referencia.
CECT 5947
2013.1
c4f_annexiitechspeciiitechoffer_es
Página 141 de 213
1.
2.
3.
4.
5.
Número
del
artículo
Especificaciones requeridas
Especificaciones ofrecidas
Notas, observaciones,
referencia a la
documentación
Notas del Comité
de Evaluación
33
Cepa de referencia internacional
Cantidad: una (1)
Staphylococcus aureus
Debe presentar genes para producir enterotoxina A
Tómese como referencia
NCTC 10652
CECT 976
34
Cepa de referencia internacional
Cantidad: una (1)
Staphylococcus aureus
Debe presentar genes para producir enterotoxina B
Tómese como referencia
ATCC 14458
NCTC 10657
CECT 4459
35
1 Cepa de referencia internacional
Cantidad: una (1)
Staphylococcus aureus
Debe presentar genes para producir enterotoxina C
Tómese como referencia
ATCC 19095
NCTC 10655
CECT 4465
2013.1
c4f_annexiitechspeciiitechoffer_es
Página 142 de 213
1.
2.
3.
4.
5.
Número
del
artículo
Especificaciones requeridas
Especificaciones ofrecidas
Notas, observaciones,
referencia a la
documentación
Notas del Comité
de Evaluación
36
Cepa de referencia internacional
Cantidad: una (1)
Staphylococcus aureus
Debe presentar genes para producir enterotoxina D
Tómese como referencia
ATCC 23235
NCTC 10656
CECT 4466
37
Cepa de referencia internacional
Cantidad: una (1)
Staphylococcus aureus
Debe presentar genes para producir enterotoxina E
Tómese como referencia
ATCC 27664
CECT 5192
38
Cepa de referencia internacional
Cantidad: una (1)
Vibrio cholerae
Serotipo non O1, Debe presentar genes para producir cholera
toxin
Tómese como referencia
NCTC 11195
2013.1
c4f_annexiitechspeciiitechoffer_es
Página 143 de 213
1.
2.
3.
4.
5.
Número
del
artículo
Especificaciones requeridas
Especificaciones ofrecidas
Notas, observaciones,
referencia a la
documentación
Notas del Comité
de Evaluación
39
Cepa de referencia internacional
Cantidad: una (1)
Listeria monocytogenes
Útil para el control de calidad de medios de cultivo y de
métodos moleculares
Tómese como referencia
ATCC 19111
CECT 7467
40
Cepa de referencia internacional
Cantidad: una (1)
Enterococcus hirae
Útil para el análisis de acido fólico.
Tómese como referencia
ATCC 8043
CECT 279
2013.1
c4f_annexiitechspeciiitechoffer_es
Página 144 de 213
1.
2.
3.
4.
5.
Número
del
artículo
Especificaciones requeridas
Especificaciones ofrecidas
Notas, observaciones,
referencia a la
documentación
Notas del Comité
de Evaluación
41
Centrifuga para Método Babcock
Cantidad: Uno (1)
 Pantalla de control digital
 Rango de velocidad ajustable: 500 – 1,300
rpm, con pasos de 1 rpm
 Rango de temperatura ajustable: del valor
ambiente 75°C, con pasos de 1°C
 Rango de duración ajustable: 1 minuto a 9.99
minutos, con pasos de 1 minuto
 Incluya un rotor y soportes en acero
inoxidable para botellas para método Babcock
 Al menos espacio para 12 butirometos para
método Babcock
 Que incluya UPS de acuerdo a su carga
 Requerimiento eléctrico 60HZ/110V, con
conectores incluidos.
GARANTÍA:



12 meses de garantía como mínimo contra
defectos de manufactura y funcionamiento.
Durante el periodo de la garantía efectuar las
reparaciones, revisiones y sustitución de
piezas dañadas sin costo adicional.
Equipo completamente nuevo, fabricado con
materiales de primera calidad.
Manual de usuario preferiblemente en idioma
español.
2013.1
c4f_annexiitechspeciiitechoffer_es
Página 145 de 213
1.
2.
3.
4.
5.
Número
del
artículo
Especificaciones requeridas
Especificaciones ofrecidas
Notas, observaciones,
referencia a la
documentación
Notas del Comité
de Evaluación
42
Campana extractora de gases y solventes
Cantidad: Tres (3)












Extractor incorporado 1/3 HP, Std
Ancho nominal 4 pies
Collar de extracción DI (10.81”)
2 (dos) Lámparas fluorescentes de 25 Watt
2 (dos) llaves de suministro de Agua y Gas
1 (Un) toma eléctrico duplex
Requerimientos eléctricos
110V/60Hz, con conectores incluidos.
Base o mesa con altura ajustable
telescópica fija con las siguientes
dimensiones generales:
48” de ancho X 29.25” de
profundidad X 27.5” – 33.5” de alto
Superficie de trabajo spill stopper
con la siguiente descripción:
48” de ancho X 30” de profundidad.
Con Ducto
INSTALACIÓN Y GARANTIA:
 El equipo será instalado en Laboratorio
Físico-Químico de Alimentos y Nutrición
CNDR-MINSA y se deberá demostrar su
funcionamiento correcto con muestras de
interés para el laboratorio.
 Deben suministrarse los manuales de
operación y mantenimiento de cada una de las
partes del equipo, de preferencia en idioma
español.
2013.1
c4f_annexiitechspeciiitechoffer_es
Página 146 de 213
1.
2.
3.
4.
5.
Número
del
artículo
Especificaciones requeridas
Especificaciones ofrecidas
Notas, observaciones,
referencia a la
documentación
Notas del Comité
de Evaluación
 Debe incluirse el plan de mantenimiento
preventivo y la verificación que se dará al
equipo durante el periodo de garantía
 Sometidas a pruebas de desempeño para ver si
cumplen con las normas ASHRAE 110-1995.
 Garantía de repuestos de al menos 5 años,
después de descontinuada su fabricación.
 Preferiblemente que tenga soporte técnico en
el país, inventario de repuestos básicos y
personal técnico capacitado.
2013.1
c4f_annexiitechspeciiitechoffer_es
Página 147 de 213
1.
2.
3.
4.
5.
Número
del
artículo
Especificaciones requeridas
Especificaciones ofrecidas
Notas, observaciones,
referencia a la
documentación
Notas del Comité
de Evaluación
43
Bomba de vacío
Cantidad: Una (1)











Diseñada para evaporaciones
rotativas con solventes de puntos de ebullición
alto
Evaporación efectiva para DMSO y
otros disolventes de alto punto de ebullición.
Vacío ajustable para regular la
ebullición
El mecanismo de engranaje de la
bomba es tolerante con los vapores
Gases de escape de gotas previene la
perdida de aceite
Libre desplazamiento de aire:
31L/min. (1.1 cfm)
Vacío final: 0.1 torr
Capacidad de aceite: 0.5 qt. (0.45L)
Diámetro de tubería: 10 mm I.D.
Dimensiones 14.5L X 5.12W X
14.37”H (36.8 X 13 X 36.3 cm.)
Requerimientos eléctricos: 115V
60Hz, con conectores incluidos.
INCLUYE:

Vacuometro /regulador de escape de
gotas
GARANTÍA:
 12 meses de garantía como mínimo contra
defectos de manufactura y funcionamiento.
Durante el periodo de garantía efectuar las
reparaciones y sustitución de piezas dañadas sin
costo adicional.
 Equipo fabricado con materiales de primera
2013.1
c4f_annexiitechspeciiitechoffer_es
calidad.
Página 148 de 213
1.
2.
3.
4.
5.
Número
del
artículo
Especificaciones requeridas
Especificaciones ofrecidas
Notas, observaciones,
referencia a la
documentación
Notas del Comité
de Evaluación
44
Evaporador con corriente de Nitrógeno
Cantidad: Uno (1)







De 24 posiciones
Rango de temperatura:
Baño de agua: 30°C -37°C(± 1°C)
Baño seco: 30°C -130°C(± 1°C)
Rango del tubo de ensayo:
Diámetro: 10mm a 30mm
Volumen: 10ml a 50ml
Características Standard:




Medidor de flujo ajustable
Tubo de teflón de alta presión para la
seguridad
Interruptor para alta temperatura
Agujas de acero inoxidable calibre
4”X19G
Características opcionales:








Control de presión de Nitrógeno
Recubrimiento de teflón resistente a
los ácidos
Colector de vacío
Caja de control lateral
Control digital
Temporizador electrónico
Purga de seguridad
Requerimiento eléctrico 110-120V,
50/60Hz. con conectores incluidos
2013.1
c4f_annexiitechspeciiitechoffer_es
Página 149 de 213
1.
2.
3.
4.
5.
Número
del
artículo
Especificaciones requeridas
Especificaciones ofrecidas
Notas, observaciones,
referencia a la
documentación
Notas del Comité
de Evaluación
GARANTÍA:



12 meses de garantía como mínimo contra
defectos de manufactura y funcionamiento.
Durante el periodo de la garantía efectuar las
reparaciones, revisiones y sustitución de
piezas dañadas sin costo adicional.
Equipo completamente nuevo, fabricado con
materiales de primera calidad.
Manual de usuario en idioma español
preferiblemente.
2013.1
c4f_annexiitechspeciiitechoffer_es
Página 150 de 213
1.
2.
3.
4.
5.
Número
del
artículo
Especificaciones requeridas
Especificaciones ofrecidas
Notas, observaciones,
referencia a la
documentación
Notas del Comité
de Evaluación
45
Limpiador ultrasónico
Cantidad : Uno (1)











Modelo digital con calefacción
Acción de limpieza profunda que
elimina los contaminantes persistentes,
incluso superficies internas
Temporizador controlado por
microprocesador
Ciclo de tiempo 99 minutos
Termostato con lectura dirigida
La unidad debe incluir tapa y cesta
sobre el fondo del tanque
Rango de temperatura: Ambiente
hasta 69°C (156°F)
Capacidad: 0.75 gal. (2.8L)
Dimensiones del tanque interior 9.5L
X 5.5W X 4”H (24.1 X 14 X 10.2 cm.)
Dimensión exterior 12L X 13.5W X
11.5”H (30.5 X 34.3 X 29.2 cm.)
Requerimientos eléctricos: 115V
60Hz 2.0A 230W, con conectores incluidos.
GARANTÍA:

12 meses de garantía contra defectos de
manufactura y funcionamiento. Durante el
periodo de la garantía efectuar las
reparaciones, revisiones y sustitución de
piezas dañadas sin costo adicional.

Manual de usuario en idioma español
preferiblemente
2013.1
c4f_annexiitechspeciiitechoffer_es
Página 151 de 213
1.
2.
3.
4.
5.
Número
del
artículo
Especificaciones requeridas
Especificaciones ofrecidas
Notas, observaciones,
referencia a la
documentación
Notas del Comité
de Evaluación
46
Refractómetro
Cantidad: Uno (1)
















Termómetro adaptable
Conexiones para calentamiento de agua en los
cuerpos de los prismas superior e inferior,
regulación de temperatura por termostato
Rangos de medición:
Índice de refracción (nD): 1,300… 1,700
Contenido de azúcar (%): 0 … 95
Rango de temperatura (°C): 0 …+70
Resolución:
Índice de refracción (nD): 0,0002
Contenido de azúcar (%): 0.25
Precisión:
Índice de refracción (nD): ±0,0002
Contenido de azúcar (%): ±0.25
Indicador: Escala dividida (parte superior %
Brix)
Parte inferior índice de refracción nD
Debe incluir un termómetro adaptable e
instrucciones de uso, 1 emulsión de naftalina,
1 destornillador y una funda protectora.
Requerimientos eléctricos: 115V 60Hz, con
conectores incluidos.
GARANTÍA:

El equipo será instalado en Laboratorio
Físico-Químico de Alimentos y Nutrición
CNDR-MINSA y se deberá demostrar su
funcionamiento correcto con muestras de
interés para el laboratorio
2013.1
c4f_annexiitechspeciiitechoffer_es
Página 152 de 213
1.
2.
3.
4.
5.
Número
del
artículo
Especificaciones requeridas
Especificaciones ofrecidas
Notas, observaciones,
referencia a la
documentación
Notas del Comité
de Evaluación




12 meses de garantía contra defectos de
manufactura y funcionamiento. Durante el
periodo de la garantía efectuar las
reparaciones, revisiones y sustitución de
piezas dañadas sin costo adicional.
Equipo completamente nuevo, fabricado con
materiales de primera calidad.
Garantía de repuestos de al menos 5 años,
después de descontinuada su fabricación.
Manual de usuario en idioma español
preferiblemente
2013.1
c4f_annexiitechspeciiitechoffer_es
Página 153 de 213
1.
2.
3.
4.
5.
Número
del
artículo
Especificaciones requeridas
Especificaciones ofrecidas
Notas, observaciones,
referencia a la
documentación
Notas del Comité
de Evaluación
47
UPS sistema alimentación ininterrumpida 3000 VA
Cantidad: Uno (1)











Rango de potencia de salida debe estar entre
2000 a 3000 VA
Voltaje de salida nominal: 120 V
Distorsión de voltaje de salida: menor del 5 %
Frecuencia de salida: 50/60 Hz
Voltaje de entrada nominal: 120 V
Rango de voltaje de entrada para las
principales operaciones: 90-150 V
Frecuencia de entrada: 50/60 Hz
Batería de plomo-acido con electrólitos
suspendidos, a prueba de fuga.
Módulos de baterías incluidos: 1
Tiempo de recarga: 3 horas.
Debe incluir CD con software,
documentación del Cd, guía de instalación,
cable RS-232, USB cable.
GARANTIA:
12 meses de garantía como mínimo contra defecto de
manufactura y mal funcionamiento.
2013.1
c4f_annexiitechspeciiitechoffer_es
Página 154 de 213
1.
2.
3.
4.
5.
Número
del
artículo
Especificaciones requeridas
Especificaciones ofrecidas
Notas, observaciones,
referencia a la
documentación
Notas del Comité
de Evaluación
48
MICROONDAS
Cantidad: Dos (2)
 Acero inoxidable,
 Dimensiones (Ancho x Profundidad x
Altura):592 x 316 x 370 mm.
 Capacidad interior: 17 L.
 Potencia del microondas:800 MB/s. Número de
nivel de potencia:5
 Requerimiento eléctrico 110, 60HZ
GARANTIA
 12 Meses de garantía como mínimo contra
defectos de manufactura y funcionamiento.
Durante el período de la garantía efectuar las
reparaciones, revisiones y sustitución de piezas
dañadas sin costo adicional para la institución.
 Equipo completamente nuevo, fabricado con
materiales de primera calidad.
INSTALACIÓN Y ENTRENAMIENTO
El equipo será instalado en el Laboratorio de
Fitosanitario y se deberá demostrar su
funcionamiento.
2013.1
c4f_annexiitechspeciiitechoffer_es
Página 155 de 213
1.
2.
3.
4.
5.
Número
del
artículo
Especificaciones requeridas
Especificaciones ofrecidas
Notas, observaciones,
referencia a la
documentación
Notas del Comité
de Evaluación
49
Congelador
Cantidad: Uno (1)
 Sistema de control por microprocesador,
circulación de aire por gravedad, calidad
industrial del gabinete construcción y pesados y
herméticamente cerrados, compresores
diseñados para actividades industriales, uso
científicos y clínicos.
 Temperatura de fábrica preconfigurada a -20ºC.
Alta densidad, CFC- libre gabinete espuma que
proteja de las fluctuaciones de la temperatura
ambiente, minimizando los costos operativos.
Sólida, puerta de cierre automático capaz de
bloquear y disponibilidad de una cerradura de
mango.
 El interior y exterior que sean de fácil limpieza.
 Modelo con disponibilidad de un
almacenamiento eficiente, fácilmente accesible a
un sistema de inventario que consta de nueve
estantes con cinco cajones por estante.
 En general este modelos tienen un sistema de
descongelación manual.
 Volumen: 659L (23.3 cu. ft.).
 Dimensiones: Interior 147.3H x 73.7D x 61Wcm
(58 x 29 x 24”), Exterior: 197H x 90.2D x 71.1W
cm (77½ x 35½ x 28”).
 Capacidad de peso: 193 kg. (425lbs)
 Requerimiento eléctrico 110 – 60HZ
2013.1
c4f_annexiitechspeciiitechoffer_es
Página 156 de 213
1.
2.
3.
4.
5.
Número
del
artículo
Especificaciones requeridas
Especificaciones ofrecidas
Notas, observaciones,
referencia a la
documentación
Notas del Comité
de Evaluación
GARANTÍA:

12 Meses de garantía como mínimo contra
defectos de manufactura y funcionamiento.
Durante el período de la garantía efectuar las
reparaciones, revisiones y sustitución de piezas
dañadas sin costo adicional para la institución.
 Equipo completamente nuevo, fabricado con
materiales de primera calidad.
 Requerimiento eléctrico de 110 60 Hz, para todo
el sistema.
 Manual de usuario en idioma español
preferiblemente.
 Deben suministrarse los manuales de operación y
mantenimiento del equipo, en idioma español
preferiblemente.
INSTALACIÓN Y ENTRENAMIENTO
El equipo será instalado en el Laboratorio de
Fitosanitario y se deberá demostrar su
funcionamiento con muestras de interés para el
laboratorio.
2013.1
c4f_annexiitechspeciiitechoffer_es
Página 157 de 213
1.
2.
3.
4.
5.
Número
del
artículo
Especificaciones requeridas
Especificaciones ofrecidas
Notas, observaciones,
referencia a la
documentación
Notas del Comité
de Evaluación
50
SISTEMA
SYSTEM)
TERMICO
ISO
(ISO
THERM-
Cantidad: Uno (1)
 Sistema modular para transportar, almacenar,
descongelación lentamente, y ultra congelación de
muestras.
 Capacidad de 24 tubos (Seguro 0.5ml, 1.5ml,
2ml).
 Paquete Normal (Paquete Frio) blanco para 0°C y
azul para -21°C, para mantener refrigerado o
congelado. Para pre-enfriamiento en el frízer.
 Tiempo isotérmico de = 6 hrs. (0°C, blanco) y = 3
hrs. (-21°C, azul).
 Que los componentes del sistema se pueden utilizar
por separado
 Debe ser autoclavable, pueden ser etiquetadas,
deben flotar en el agua y puede ser centrifugados
en una placa rotor de micro titulación.
 Requerimiento eléctrico 110 – 60HZ
GARANTÍA

12 Meses de garantía contra defectos de
manufactura y funcionamiento. Durante el período
de la garantía efectuar las reparaciones, revisiones
y sustitución de piezas dañadas sin costo adicional
para la institución.
2013.1
c4f_annexiitechspeciiitechoffer_es
Página 158 de 213
1.
2.
3.
4.
5.
Número
del
artículo
Especificaciones requeridas
Especificaciones ofrecidas
Notas, observaciones,
referencia a la
documentación
Notas del Comité
de Evaluación
51
AGITADOR MAGNETICO
Cantidad: Uno (1)














Para calentar y revolver hasta seis vasos
simultáneamente.
Que permite el control de la regulación específica
de agitación.
Calentador con encendido rápido y de manera
uniforme a 320 °C (608 °F), con variador con
termostato.
Calentador con superficie de aluminio fundido.
Es adecuado hasta para seis matraces de 1000ml
a un mismo tiempo.
Agitación de hasta un rango de 1.200 rpm,
líquidos con viscosidad de 0 a 100% de glicerol.
Los controles independientes permiten al
operador a agitar, calor o agitar y calentar
líquidos.
Separar los interruptores (o switches de
encendido y apagado) que permita parar o
controlar la acción.
Los interruptores de encendido con pilotos
luminosos.
La unidad del agitador se alimenta con seis
motores permanentemente lubricados
Dimensiones: 45.7w x 30.5D cm (18 x 12”),
Overall: 45.7W x 35.5D x 19H cm (18 x 14 x 7
½”)
Requerimiento Electrico 120v.
Capacidad de Peso: 19.1 Kg (42 lbs)
Requerimiento eléctrico 110 – 60HZ
2013.1
c4f_annexiitechspeciiitechoffer_es
Página 159 de 213
1.
2.
3.
4.
5.
Número
del
artículo
Especificaciones requeridas
Especificaciones ofrecidas
Notas, observaciones,
referencia a la
documentación
Notas del Comité
de Evaluación
GARANTÍA:
12 Meses de garantía como mínimo contra defectos
de manufactura y funcionamiento. Durante el período
de la garantía efectuar las reparaciones, revisiones y
sustitución de piezas dañadas sin costo adicional para
la institución
2013.1
c4f_annexiitechspeciiitechoffer_es
Página 160 de 213
1.
2.
3.
4.
5.
Número
del
artículo
Especificaciones requeridas
Especificaciones ofrecidas
Notas, observaciones,
referencia a la
documentación
Notas del Comité
de Evaluación
52
MEZCLADOR (VORTEX MIXER)
Cantidad: Uno (1)
 Diseñado para procedimientos con vasos y
capaces de homogenizar en minutos.
 Incluye un mezclador fácil de cargar para doce
micro tubos de centrífuga de 1.5ml o 2.0ml.
 El micro-tubo tiene integrado un vaso con
cabeza, que permite que la sustancia se mezcle
mediante el uso de un mezclador estándar durante
el encendido.
 El Mezclador posee también un micro
procesador que es controlado con interfaz digital
con características independientes de la muestra,
pero con velocidad y tiempo de exacto.
 Información requerida: Agitador se requiere
con un cup head y 7.6cm (3 ") cabeza de cubrir
 Disponibilidad de accesorio como tubos y micro
platos, para adaptarse al mezclador y usarlos
con un volumen mayor de muestras
 Requerimiento Electrico 120v
GARANTÍA:
 12 meses de garantía como mínimo contra
defectos de manufactura y funcionamiento.
 Durante el período de la garantía efectuar las
reparaciones revisiones y sustitución de piezas
dañadas sin costo adicional para la institución
2013.1
c4f_annexiitechspeciiitechoffer_es
Página 161 de 213
1.
2.
3.
4.
5.
Número
del
artículo
Especificaciones requeridas
Especificaciones ofrecidas
Notas, observaciones,
referencia a la
documentación
Notas del Comité
de Evaluación
53
FLUJO LAMINAR, PURIFICADOR * * CON
BASE
Cantidad: Uno (1)
 Sistema de monitoreo del filtro que consiste en
un motor vía electrónica (ECM) que está
programado para enviar la cantidad exacta de aire
requerido y automáticamente se ajusta como
filtros de carga, sin depender de la circulación del
aire sensores.
 Fabricado en ECM para que consuma 60%
menos de energía, proporciona ambiente más
fresco y tranquilo, y más poder para una mayor
carga del filtro HEPA.
 Permite al usuario programar, la puesta en
marcha y apagar o cerrar su funcionamiento.
 Cabinas que también tiene una característica
incorporada o Cronómetro de tiempo para el
control de luz UV o monitoreo de vigilancia y
control manual para la activación del ventilador,
luz, un cronómetro, alarma acústica y selección
del menú.
 Modelo con servicio de accesorio, que también
incluyen una lámpara ultravioleta para
descontaminación.
 Modelo con 1.8m (6`) .
 Dimensiones: 79.2D x 156H cm ( 313/16
 Requerimiento Electrico 110v – 60HZ
GARANTIA
 12 Meses de garantía como mínimo contra
defectos de manufactura y funcionamiento.
institución.
2013.1
c4f_annexiitechspeciiitechoffer_es
Página 162 de 213
1.
2.
3.
4.
5.
Número
del
artículo
Especificaciones requeridas
Especificaciones ofrecidas
Notas, observaciones,
referencia a la
documentación
Notas del Comité
de Evaluación
 Durante el período de la garantía efectuar las
reparaciones, revisiones y sustitución de piezas
dañadas sin costo adicional para la institución
 Equipo completamente nuevo, fabricado con
materiales de primera calidad.

INSTALACIÓN
 El equipo será instalado en el Laboratorio
Fitosanitario y se deberá demostrar su
funcionamiento con muestras de interés para el
laboratorio.
2013.1
c4f_annexiitechspeciiitechoffer_es
Página 163 de 213
1.
2.
3.
4.
5.
Número
del
artículo
Especificaciones requeridas
Especificaciones ofrecidas
Notas, observaciones,
referencia a la
documentación
Notas del Comité
de Evaluación
54
CALENTADOR DE ALUMINIO, INCUBADOR
DE TUBOS (HEATING BLOCKS)
Cantidad: Uno (1)










Designado para multiple propósitos.
Temperatura uniforme, excelente y exacta.
Hold intercambiables, Modular Bloques caliente
Hold intercambiables, Modular Calefacción
Bloques 150⁰C.
Rango de temperatura: 5⁰ a 150⁰C .
Estabilidad de Temperatura: ±2⁰C, Uniformidad
de Temperatura: ±5⁰C .
Dimensiones: L X D X H cm : 42.9 x 20.3 x 8.9.
Requerimiento Electrico 110v -60 HZ
tipo de tubo es 0,5ml; 1,5ml; 2ml para PCR.
El calentador necesita 10 diferentes
termobloques intercambiables
2013.1
c4f_annexiitechspeciiitechoffer_es
Página 164 de 213
1.
2.
3.
4.
5.
Número
del
artículo
Especificaciones requeridas
Especificaciones ofrecidas
Notas, observaciones,
referencia a la
documentación
Notas del Comité
de Evaluación
55
DESTILADOR DE AGUA
Cantidad: Uno (1)
 FI-III: Dekernion Jb Destilador de vidrio, que
proporcione agua Tipo II que esté libre de
partículas, los sólidos suspendidos, y pirógenos
para aplicaciones de laboratorio.
 presión máxima de 80 psig, y tienen una presión
mínima de 15 sig. Pared o banqueta montado.
 Capacidad de destilación de Agua: 8L/hr,
 Enfriamiento del agua: 120L/hr, No. f
Calentador: 4,
 Dimensiones: 74.9 x 48.3 x 38.1 cm,
 Capacidad de Peso: 36.3 kg.
 Requerimiento Electrico 220v -60HZ
GARANTIA
 12 Meses de garantía como mínimo contra
defectos de manufactura y funcionamiento.
Durante el período de la garantía efectuar las
reparaciones, revisiones y sustitución de piezas
dañadas sin costo adicional para la institución.
2013.1
c4f_annexiitechspeciiitechoffer_es
Página 165 de 213
1.
2.
3.
4.
5.
Número
del
artículo
Especificaciones requeridas
Especificaciones ofrecidas
Notas, observaciones,
referencia a la
documentación
Notas del Comité
de Evaluación
56
MICROCENTRIFUGA
Cantidad: Uno (1)
 Microcentrifuga con rotor intercambiables, los
cuales son autoclavable a 121ºC , 250 °F.
 Sistema de refrigerado con un mecanismo de
seguridad de la tapa, ajuste de la temperatura de
0 a 40ºC (de 2 a 104 °F), y " rápido enfriamiento
" Función de enfriamiento del rotor a partir del
medio 4 ºC (39,2 ºF) en menos de 16 minutos.
 Máxima velocidad: 13,200rpm
 Máxima RCF 16,110g
 Tiempo: 30 sec. to 99 min
 Dimensiones, CM (IN): 29 x 45 x 23 ( 11 x 18 x
9)
 Peso, Kg(lbs): 21.2 (46.7)
 El tamaño del tubo que se utiliza es de 1,5 ml a 2
ml para PCR.
 Requerimiento Electrico 110v – 60HZ
 Equipo completamente nuevo, fabricado con
materiales de primera calidad.
2013.1
c4f_annexiitechspeciiitechoffer_es
Página 166 de 213
1.
2.
3.
4.
5.
Número
del
artículo
Especificaciones requeridas
Especificaciones ofrecidas
Notas, observaciones,
referencia a la
documentación
Notas del Comité
de Evaluación
INSTALACIÓN Y ENTRENAMIENTO
 El equipo será instalado en el Laboratorio de
Fitosanitario y se deberá demostrar su
funcionamiento con muestras de interés para el
laboratorio durante el curso de entrenamiento en
el mismo.
 Entrenamiento de aproximadamente 2 semanas,
al personal designado por la institución para la
utilización del equipo, garantizando su total
manejo operativo, avalado por un certificado de
la Empresa.
57
AUTOCLAVE
Cantidad: 1 (uno)







Capacidad 80 L
Rango Temperatura trabajo. 105ºC – 140ºC
Purgado automático/vacío
Tiempo trabajo: 3 – 180 minutos
Purgado por bomba vacío, fraccionado y
atmosférico
Válvula y presostato de seguridad
Control por microprocesador
2013.1
c4f_annexiitechspeciiitechoffer_es
Página 167 de 213
1.
2.
3.
4.
5.
Número
del
artículo
Especificaciones requeridas
Especificaciones ofrecidas
Notas, observaciones,
referencia a la
documentación
Notas del Comité
de Evaluación
58
Campana bacteriológica
Cantidad: Uno (1)








Clase II,
Tipo A2
Dimensiones: 61.5”Hx31.25”D(156x79cm)
Ancho 42 pulgadas (107 cm),
Marco de abertura 8 pulgadas (20 cm),
Con lámpara fluorescente/ultravioleta
Con filtros HEPA 99.99% de eficiencia
Con base incluida

Requerimiento eléctrico 110V/60Hz
GARANTIA:



12 meses de garantía como mínimo contra
defectos de manufactura y funcionamiento,
durante el periodo de la garantía, efectuar las
reparaciones, revisiones y sustitución de piezas
dañadas sin costo adicional.
Equipo completamente nuevo, fabricado con
materiales de primera calidad,
Manual de usuario en idioma español
preferiblemente.
2013.1
c4f_annexiitechspeciiitechoffer_es
Página 168 de 213
1.
2.
3.
4.
5.
Número
del
artículo
Especificaciones requeridas
Especificaciones ofrecidas
Notas, observaciones,
referencia a la
documentación
Notas del Comité
de Evaluación
59
Centrifuga de 24 plazas con rotor
Cantidad: Dos (2)




15,000 rpm,
Rotor para 24 tubos incluido
Tubos de 1,5 ml a 2 ml para PCR
Requerimiento eléctrico 110V/60Hz
GARANTIA:



12 meses de garantía como mínimo contra
defectos de manufactura y funcionamiento,
durante el periodo de la garantía, efectuar las
reparaciones, revisiones y sustitución de piezas
dañadas sin costo adicional.
Equipo completamente nuevo, fabricado con
materiales de primera calidad,
Manual de usuario en idioma español de
preferencia.
2013.1
c4f_annexiitechspeciiitechoffer_es
Página 169 de 213
1.
2.
3.
4.
5.
Número
del
artículo
Especificaciones requeridas
Especificaciones ofrecidas
Notas, observaciones,
referencia a la
documentación
Notas del Comité
de Evaluación
60
Esterilizador a presión (autoclave)
Cantidad: Una (1)










Capacidad: 3 pies cúbicos
Temperatura hasta 121oC (250oF)
Temperatura variable: desde 110oC hasta 121oC
Presión de operación 15 psi (1atm/100kPa
Con reloj de control de 60 minutos
Dimensiones:
Overall: 31L x 18 3/4W x 29”H (79 x 48 x 74cm)
Cámara: 16” de diámetro x 26”D (41 x 66cm)
Peso neto: 150lb. (68kg)
Requerimiento eléctrico de 208-240V, 60Hz.
Incluye:


Carta de temperatura
Cable de alimentación
GARANTÍA:





12 meses de garantía como mínimo contra
defectos de manufactura y funcionamiento.
Durante el periodo de la garantía efectuar las
reparaciones, revisiones y sustitución de piezas
dañadas sin costo adicional.
Equipo completamente nuevo, fabricado con
materiales de primera calidad.
Manual de usuario en idioma español de
preferencia.
El equipo será instalado en Laboratorio Central
de diagnóstico veterinario y microbiología de
alimentos
La instalación debe incluir la verificación
completa de funcionamiento con certificado UL,
CSA.
2013.1
c4f_annexiitechspeciiitechoffer_es
Página 170 de 213
1.
2.
3.
4.
5.
Número
del
artículo
Especificaciones requeridas
Especificaciones ofrecidas
Notas, observaciones,
referencia a la
documentación
Notas del Comité
de Evaluación
61
Hornillas con agitador magnético
Cantidad: Cuatro (4)
Con rango de velocidad ajustable de 60 a 1200 rpm,
tecnología Stric Trac para agitación de baja velocidad
mejorada, control de velocidad constante y
acoplamiento magnético más fuerte, barra de agitación
de frenado rápido y anillo de soporte integrado para
acomodar varilla de soporte de 1/2 " (1,3 cm) de
diámetro.
 Área de superficie de agitación: 10 ¼ x 10 ¼”
(26 x 26 cm), cerámica Capacidad: 35 lbs. (6.8 kg.)
 Rango de agitación: de 60 a 1200 rpm
 Rango de temperatura: 5oC a 500oC
 Dimensiones: 16 ¼L x 11 3/8W x 4” (41 x 29 x
10 cm)
 Requerimientos eléctricos: 120V 60Hz
 12 meses de garantía contra defectos de
manufactura y funcionamiento, durante la
garantía, efectuar las reparaciones, revisiones y
sustitución de piezas dañadas sin costo adicional.
 Certificado CSA
 Equipo nuevo fabricado con materiales de
primera calidad,
 La instalación debe incluir verificación completa
de funcionamiento con certificado UL, CSA.
 De preferencia con soporte técnico en el país,
inventario de repuestos básicos y personal
técnico capacitado
 Manual de usuario en idioma español
preferiblemente.
2013.1
c4f_annexiitechspeciiitechoffer_es
Página 171 de 213
1.
2.
3.
4.
5.
Número
del
artículo
Especificaciones requeridas
Especificaciones ofrecidas
Notas, observaciones,
referencia a la
documentación
Notas del Comité
de Evaluación
62
Afilador automático de cuchillas para micrótomo
Cantidad: Uno (1)
Afilador automático de cuchillas de micrótomo,
Vigente a partir del perfil afilado Cuchillos hasta
185 mm de longitud. Titular Cuchillo universal para
adaptarse a diferentes longitudes.
Cambio automático / Reversión, Automático de 0-60
minutos temporizador. Montado sobre patas de goma
para absorber las vibraciones.
Incluye:
Un conjunto de dos placas de vidrio bruñido, dos
botellas de abrasivo grueso, dos botellas de abrasivo
fino, dos botellas de vidrio compuesto para pulir, un
porta cuchillas para cuchillas hasta de 16 cm (6 1/16”),
un bloque de madera para inspección, un juego de
fusibles de repuesto y tres cables cable de
alimentación.




Requerimientos eléctrico: 120V 60Hz
12 meses de garantía como mínimo contra
defectos de manufactura y funcionamiento,
durante el periodo de la garantía, efectuar las
reparaciones, revisiones y sustitución de piezas
dañadas sin costo adicional.
Equipo completamente nuevo, fabricado con
materiales de primera calidad,
Manual de usuario en idioma español
preferiblemente.
2013.1
c4f_annexiitechspeciiitechoffer_es
Página 172 de 213
1.
2.
3.
4.
5.
Número
del
artículo
Especificaciones requeridas
Especificaciones ofrecidas
Notas, observaciones,
referencia a la
documentación
Notas del Comité
de Evaluación
63
Batería de tinción
Cantidad: Dos (2)
Plato de tinción rectangular con cubierta de vidrio para
la tinción de las muestras en portaobjetos
Incluye:
Estante de cristal desmontable para portaobjetos,
gradilla para 20 portaobjetos de 75 x 25 mm (3 x 1”),
75 x 38mm (3 x 1 ½ “ o 75 x 50 mm (3 x 2”).
Fabricados con vidrio sodo-cálcico.
Descripción: Caja de tinción completa,
Dimensiones internas:
9.5L x 7.6W x 6-4D cm (3 ¼ x 3 x 2 ½ “)
2013.1
c4f_annexiitechspeciiitechoffer_es
Página 173 de 213
1.
2.
3.
4.
5.
Número
del
artículo
Especificaciones requeridas
Especificaciones ofrecidas
Notas, observaciones,
referencia a la
documentación
Notas del Comité
de Evaluación
64
Baño maría para flotación de tejidos
Cantidad: Uno (1)
Diseñado especialmente para el ensayo y los
procedimientos que utilizan cultivo de tejidos. Que
pueda utilizarse en la preparación de sección de tejido
parafina y la eliminación de arrugas y distorsiones de
las secciones de tejido.







Rango de temperatura: 35º a 65ºC (95 a 149º F)
Sensibilidad: ± 1º C
Dimensiones:
Cámara: 21 diámetro x 50D cm (8 ¼ x 2”)
Por fuera: 28 diámetro x 9.2H cm (11 x 3 5/8”)
Borde: 3.2 cm (1 1/4”)
Requerimiento eléctrico: 115V 50/60Hz
GARANTÍA:




12 meses de garantía como mínimo contra
defectos de manufactura y funcionamiento.
Durante el periodo de la garantía efectuar las
reparaciones, revisiones y sustitución de piezas
dañadas sin costo adicional.
Equipo completamente nuevo, fabricado con
materiales de primera calidad.
De preferencia que tenga soporte técnico en el
país, inventario de repuestos básicos y personal
técnico capacitado.
Manual de usuario en idioma español
preferiblemente.
2013.1
c4f_annexiitechspeciiitechoffer_es
Página 174 de 213
1.
2.
3.
4.
5.
Número
del
artículo
Especificaciones requeridas
Especificaciones ofrecidas
Notas, observaciones,
referencia a la
documentación
Notas del Comité
de Evaluación
65
Sistema de Ultra purificación de agua para PCR
con todos sus accesorios para su funcionamiento.
Producción de agua de 15 a 20 litros por día
Cantidad: Uno (1)
GARANTIA:




12 meses como mínimo contra defectos de
manufactura y funcionamiento. Durante el
periodo de la garantía efectuar las reparaciones,
revisiones y sustitución de piezas dañadas sin
costo adicional.
Equipo completamente nuevo, fabricado con
materiales de primera calidad.
De preferencia que tenga soporte técnico en el
país, inventario de repuestos básicos y personal
técnico capacitado.
Manual de usuario en idioma español
preferiblemente.
2013.1
c4f_annexiitechspeciiitechoffer_es
Página 175 de 213
1.
2.
3.
4.
5.
Número
del
artículo
Especificaciones requeridas
Especificaciones ofrecidas
Notas, observaciones,
referencia a la
documentación
Notas del Comité
de Evaluación
66
STD Caja de pase para descontaminación de
muestras (Pass Thru Box)
Cantidad: Uno (1)
Dimensiones:
 STD 181818 (PW) 18", (OH) 18", (OD) 18",
(IW) 15", (IH) 16", (ID) 17", 1/4"
 Puertas gruesas.
 Requerimiento eléctrico: 115V 50/60Hz
GARANTIA:

12 meses de garantía como mínimo contra
defectos de manufactura y funcionamiento.
Durante el periodo de la garantía efectuar las
reparaciones, revisiones y sustitución de piezas
dañadas sin costo adicional.

Equipo completamente nuevo, fabricado con
materiales de primera calidad.

De preferencia que tenga soporte técnico en el
país, inventario de repuestos básicos y personal
técnico capacitado.

Manual de usuario en idioma
preferiblemente, en su defecto ingles.
2013.1
c4f_annexiitechspeciiitechoffer_es
español
Página 176 de 213
1.
2.
3.
4.
5.
Número
del
artículo
Especificaciones requeridas
Especificaciones ofrecidas
Notas, observaciones,
referencia a la
documentación
Notas del Comité
de Evaluación
67
STD Caja de pase para descontaminación de
muestras (Pass Thru Box)
Cantidad: Uno (1)
Dimensiones:
 ETS 363 624 (VP) 36 ", (OH) 36", (DO) de 24 ",
(IW) 33", (IH) 34 ", (ID) de 22.5", 1/2 "
 Puertas gruesas.
 Requerimiento eléctrico: 115V 50/60Hz
GARANTÍA:

12 meses de garantía como mínimo contra
defectos de manufactura y funcionamiento.
Durante el periodo de la garantía efectuar las
reparaciones, revisiones y sustitución de piezas
dañadas sin costo adicional.

Equipo completamente nuevo, fabricado con
materiales de primera calidad.

De preferencia que tenga soporte técnico en el
país, inventario de repuestos básicos y personal
técnico capacitado.

Manual de usuario en idioma español
preferiblemente, en su defecto ingles.
2013.1
c4f_annexiitechspeciiitechoffer_es
Página 177 de 213
1.
2.
3.
4.
5.
Número
del
artículo
Especificaciones requeridas
Especificaciones ofrecidas
Notas, observaciones,
referencia a la
documentación
Notas del Comité
de Evaluación
68
Campana de extracción (Hood)
Cantidad: Uno (1)
Baja velocidad del ventilador de escape 0.11sp frete a
75pm
Construcción:
Con cuello único de escape, rectangular para mayor
espacio vertical, forro de poli resina, baja propagación
de la llama y que cumpla con las normas NFPAProvisto de espacio para colocar un interruptor de
ventilación opcional o monitores de seguridad
Dimensiones:
 57.50H x 31.25”D (146 x 79cm) (total)
 Ancho de la campana: 96” (122cm)
 Hoja abierta de 18” (100cfm (0.09H2O)
 Hoja completamente abierta: 1570cfm (0,21
H2O)
 Mrf No.: 54l0029P0BE
 Escape de presión estática total: <100fpm
 Requerimiento eléctrico: 115V 50/60Hz
Debe cumplir con las normas de clasificado y
etiquetado UL 1805 y adherirse a los parámetros de
pruebas ASHRAE para trazas de gas.
2013.1
c4f_annexiitechspeciiitechoffer_es
Página 178 de 213
1.
2.
3.
4.
5.
Número
del
artículo
Especificaciones requeridas
Especificaciones ofrecidas
Notas, observaciones,
referencia a la
documentación
Notas del Comité
de Evaluación
GARANTÍA:

12 meses de garantía como mínimo contra
defectos de manufactura y funcionamiento.
Durante el periodo de la garantía efectuar las
reparaciones, revisiones y sustitución de piezas
dañadas sin costo adicional.

Equipo completamente nuevo, fabricado con
materiales de primera calidad.

De preferencia que tenga soporte técnico en el
país, inventario de repuestos básicos y personal
técnico capacitado.

Manual de usuario en idioma español
preferiblemente, en su defecto ingles.
2013.1
c4f_annexiitechspeciiitechoffer_es
Página 179 de 213
1.
2.
3.
4.
5.
Número
del
artículo
Especificaciones requeridas
Especificaciones ofrecidas
Notas, observaciones,
referencia a la
documentación
Notas del Comité
de Evaluación
69
pHmetro
Cantidad: Dos (2)
Incluye:
Medidor, electrodos, módulos de soporte, fuente de
alimentación, instrucciones.
 pH, conductividad
 Requerimiento eléctrico: 115V 50/60Hz
GARANTÍA:

12 meses de garantía como mínimo contra
defectos de manufactura y funcionamiento.
Durante el periodo de la garantía efectuar las
reparaciones, revisiones y sustitución de piezas
dañadas sin costo adicional.

Equipo completamente nuevo, fabricado con
materiales de primera calidad.

Garantía de repuestos de al menos 5 años,
después de descontinuada su fabricación.

Manual de usuario en idioma español
preferiblemente, en su defecto ingles.
2013.1
c4f_annexiitechspeciiitechoffer_es
Página 180 de 213
1.
2.
3.
4.
5.
Número
del
artículo
Especificaciones requeridas
Especificaciones ofrecidas
Notas, observaciones,
referencia a la
documentación
Notas del Comité
de Evaluación
70
Set de pesas certificadas OIML, clase M 2
Cantidad: Dos (2) (cajas)
Incluye:
Caja de polipropileno con tapa y pinzas.
Descripción
 1 a 2000 gr Unidades de peso en grs.: una de 2000 gr., una de
1000 gr., una de 500 gr., una de 200 gr., una de
100 gr., una 50 gr., una de 20 gr., una de 10 gr.,
una de 5 gr., una de 2 gr., una de 1 gr.
GARANTÍA:

Debe cumplir con las tolerancias de la OIML

Manual de usuario en idioma español
2013.1
c4f_annexiitechspeciiitechoffer_es
Página 181 de 213
1.
2.
3.
4.
5.
Número
del
artículo
Especificaciones requeridas
Especificaciones ofrecidas
Notas, observaciones,
referencia a la
documentación
Notas del Comité
de Evaluación
71
Esterilizador de asa bacteriológicas
(Microincinerador)
Cantidad: Seis (6)
 Unidad de esterilización de asa bacteriológicas o
agujas de metal, esteriliza en 5 o 7 segundos.
 Con calor infrarojo dentro de un tubo de
cerámica elimina la necesidad de gases
peligrosos y llamas.
 Con capa de acero inoxidable que proteja el
elemento de calor
 Con pie de copa de succión que asegure que la
base no se mueva
 Con certificación UL
 Requerimiento eléctrico: 115V 50/60Hz
GARANTÍA:

12 meses de garantía como mínimo contra
defectos de manufactura y funcionamiento..

Equipo completamente nuevo, fabricado con
materiales de primera calidad.

Garantía de repuestos de al menos 5 años,
después de descontinuada su fabricación.

Manual de usuario en idioma español
preferiblemente.
2013.1
c4f_annexiitechspeciiitechoffer_es
Página 182 de 213
1.
2.
3.
4.
5.
Número
del
artículo
Especificaciones requeridas
Especificaciones ofrecidas
Notas, observaciones,
referencia a la
documentación
Notas del Comité
de Evaluación
72
Congelador vertical ultra-baja temperatura
Cantidad: Uno (1)
Rango de temperatura: -50 a -80oC
Volumen: de 500 a 800 L
Dimensiones:

Interior: 38.7W x 30.5D x 24.4H cm.

Exterior: 78.1W x 61D x 50.8H cm.

Requerimiento eléctrico: 115V 50/60Hz
Garantía:

12 meses de garantía como mínimo contra
defectos de manufactura y funcionamiento..

Equipo completamente nuevo, fabricado con
materiales de primera calidad.

Garantía de repuestos de al menos 5 años,
después de descontinuada su fabricación.

Manual de usuario en idioma español de
preferncia, en su defecto ingles.
2013.1
c4f_annexiitechspeciiitechoffer_es
Página 183 de 213
1.
2.
3.
4.
5.
Número
del
artículo
Especificaciones requeridas
Especificaciones ofrecidas
Notas, observaciones,
referencia a la
documentación
Notas del Comité
de Evaluación
73
Sistema de bomba de vacio (Dryfast and
Dryfastultra)
Cantidad: 1 (uno)
Dimensiones: 20.6 x 22.4 x 25.4
Máximo de vacío: 660 mmHg
Requerimiento eléctrico: 115V 50/60Hz
Bomba de vacío resistente a químicos con un
desplazamiento de aire de (0,31 a 112) CFM (0, 53 –
190) m3/h.
Garantía:

12 meses de garantía como mínimo contra
defectos de manufactura y funcionamiento..

Equipo completamente nuevo, fabricado con
materiales de primera calidad.

Garantía de repuestos de al menos 5 años,
después de descontinuada su fabricación.

Manual de usuario en idioma español
preferiblemente.
2013.1
c4f_annexiitechspeciiitechoffer_es
Página 184 de 213
1.
2.
3.
4.
5.
Número
del
artículo
Especificaciones requeridas
Especificaciones ofrecidas
Notas, observaciones,
referencia a la
documentación
Notas del Comité
de Evaluación
74
Horno de calor seco
Cantidad: 2 (dos)
Rango de temperatura: 5 a 240oC (9 a 460 oF)
Dimensiones:

Internas: 33W x 35.6D x 37.5H

Externas: 54W x 60.3D x 84H cm
Requerimiento eléctrico: 115V 50/60Hz
 La capacidad de la cámara puede ser entre 50 a
60 litros, el rango de temperatura puede ser de
50 °C a 225 °C o de 50°C a 150 °C, se puede
aceptar un horno con las dimensiones externas
mencionadas.
Garantía:
 12 meses de garantía como mínimo contra
defectos de manufactura y funcionamiento..
 Equipo completamente nuevo, fabricado con
materiales de primera calidad.
 Garantía de repuestos de al menos 5 años,
después de descontinuada su fabricación.
 Manual de usuario en idioma español
prefeiblemente.
2013.1
c4f_annexiitechspeciiitechoffer_es
Página 185 de 213
1.
2.
3.
4.
5.
Número
del
artículo
Especificaciones requeridas
Especificaciones ofrecidas
Notas, observaciones,
referencia a la
documentación
Notas del Comité
de Evaluación
75
Destilador de agua automático MP6A con sus
accesorios
Cantidad: 2 (dos)
Volumen de producción: 6 litros/hora
Capacidad de calentamiento del agua: 53L/Hra.
Dimensiones:

114.3H x 58.4W x 30.5D cm
Peso de operación 49.9kg (110 lbs)
Número de calentadores: 2
Accesorios Botella de vidrio Pyrex de 13 litros
Boiler body
Resistencia de inmersión (1)
Requerimiento eléctrico: 220/240V 50/60Hz 30A
Garantía:
 12 meses de garantía como mínimo contra
defectos de manufactura y funcionamiento..
 Equipo completamente nuevo, fabricado con
materiales de primera calidad.
 Garantía de repuestos de al menos 5 años,
después de descontinuada su fabricación.
 Manual de usuario en idioma español
preferiblemente.
2013.1
c4f_annexiitechspeciiitechoffer_es
Página 186 de 213
1.
2.
3.
4.
5.
Número
del
artículo
Especificaciones requeridas
Especificaciones ofrecidas
Notas, observaciones,
referencia a la
documentación
Notas del Comité
de Evaluación
76
Homogenizador de Paletas (aboratorio blenders
400)
Cantidad: 1 (uno)
Capacidad: 80 - 400 ml
Procesa muestras hasta de 400 ml,
Memoria programable en velocidad y tiempo (de 1
segundo a 99.56 minutos)
Dimensiones: 33.6 x 33.6 x 27.9 cm
Requerimiento eléctrico: 110V 50/60Hz 170w
Garantía:
 12 meses de garantía como mínimo contra
defectos de manufactura y funcionamiento..
 Equipo completamente nuevo, fabricado con
materiales de primera calidad.
 Garantía de repuestos de al menos 5 años,
después de descontinuada su fabricación.
 Manual de usuario en idioma español
preferiblemente.
2013.1
c4f_annexiitechspeciiitechoffer_es
Página 187 de 213
1.
2.
3.
4.
5.
Número
del
artículo
Especificaciones requeridas
Especificaciones ofrecidas
Notas, observaciones,
referencia a la
documentación
Notas del Comité
de Evaluación
77
Pipeteador volumen ajustable 1 ä 100 ml
Cantidad: 2 (dos)
Modelo estandar
Pipeteador con alimentación eléctrica para dispensar
volúmenes 1 a 100 ml
Para trabajar con pipetas de vidrio y plásticas
autoclavable
Requerimiento eléctrico: 110V 60Hz
Garantía:
 12 meses de garantía como mínimo contra
defectos de manufactura y funcionamiento..
 Equipo completamente nuevo, fabricado con
materiales de primera calidad.
 Garantía de repuestos de al menos 5 años,
después de descontinuada su fabricación.
 Manual de usuario en idioma español de
preferencia.
2013.1
c4f_annexiitechspeciiitechoffer_es
Página 188 de 213
1.
2.
3.
4.
5.
Número
del
artículo
Especificaciones requeridas
Especificaciones ofrecidas
Notas, observaciones,
referencia a la
documentación
Notas del Comité
de Evaluación
78
Norma OIE para laboratorios veterinarios
Cantidad: 1 (uno)
Norma OIE compatible con Norma ISO 17025 para
garantía de calidad en laboratorios veterinarios.
En idioma español
79
Termómetros
Cantidad: 40 (cuarenta)

digital con punta de acero
rango -50 a 300 o C
80
pHmetro
Cantidad: 40 (cuarenta)

portátil
rango 0-14
81
Lactodensímetro
Cantidad: 20 (veinte)

escala 15-40,
largo 250mm,0.5 divisiones
2013.1
c4f_annexiitechspeciiitechoffer_es
Página 189 de 213
1.
2.
3.
4.
5.
Número
del
artículo
Especificaciones requeridas
Especificaciones ofrecidas
Notas, observaciones,
referencia a la
documentación
Notas del Comité
de Evaluación
82
Microscopio compuesto con cámara
Cantidad: 1 (uno)
Binocular, objetivo4x,10x,40x,100x . Aceite imersion,
objetivos planachromasticos . Iluminacion de Koehler
6v 20w lamp with. Dimension 27x21x43 cm para 110
v
Mirilla micrometrica
Linear 10mm,0.1mm
83
Lector de código de barra
Cantidad: 20 (veinte)



Diseño resistente: tarjeta de circuitos única,
sometido a las pruebas de caídas desde 1,5 m de
Symbol
Interfaces múltiples: RS-232, USB, interfaz de
teclado (KeyboardWedge) en un solo lector
Diseño ergonómico híbrido: ligero, elegante y
equilibrado
Lectura intuitiva: diseño plug and play.
84
Termómetros
Cantidad: 30 (treinta)
Hygrometer test 608-h1
Digital de 8 pulg de largo con un rango grado
de medición de tremperatura de 58°F a 302°F,
puede medir temperaturas de cuartos fríos,
vegetales y frutas.
2013.1
c4f_annexiitechspeciiitechoffer_es
Página 190 de 213
1.
2.
3.
4.
5.
Número
del
artículo
Especificaciones requeridas
Especificaciones ofrecidas
Notas, observaciones,
referencia a la
documentación
Notas del Comité
de Evaluación
85
Cribas
Cantidad: 30 (treinta)
Para muestro de granos
10 Cribas de Maíz: set de 2 cribas (12/64" y 6/64"
perforación redonda) con pana.
10 Cribas de Sorgo: set de 2 cribas (5/64" perforación
triangular y 2-1/2/64" perforación redonda) con pana.
10 Cribas de Arroz: set de 3 cribas (5-1/2/64", 6/64" y
6-1/2/64" perforación redonda) con pana
2013.1
c4f_annexiitechspeciiitechoffer_es
Página 191 de 213
1.
2.
3.
4.
5.
Número
del
artículo
Especificaciones requeridas
Especificaciones ofrecidas
Notas, observaciones,
referencia a la
documentación
Notas del Comité
de Evaluación
86
Electrodo Combinado de pH
Cantidad: 1 (uno)








Rango de pH de 0 a 14
Rango de temperatura -5 a +100 °C
Longitud 106 mm
Diámetro 10 mm
Con Cubierta de protección extraíble del
electrodo
Conector BNC
Cuerpo de vidrio
Elemento de referencia, alambre de
Ag/AgCl
1 Sonda C.A.T.


Con señal de temperatura para la
compensación automática.
Conectores resistentes al agua.
2013.1
c4f_annexiitechspeciiitechoffer_es
Página 192 de 213
1.
2.
3.
4.
5.
Número
del
artículo
Especificaciones requeridas
Especificaciones ofrecidas
Notas, observaciones,
referencia a la
documentación
Notas del Comité
de Evaluación
87
Balanza Analítica
Cantidad: 1 (uno)








88
Rango de Pesado: 0 a 260 gr
Legibilidad : 0.1 mg
Rango de tarado (por substracción): 0
a 260 gr
Repetibilidad: 0.1 mg
Linearibilidad: + 0.3 mg
Tiempo de Estabilización: 3 segundos
Diámetro de la pana: 3.50" ( 9cm)
Dimensiones Aproximadas:
11.87x8.75x12" (30x22x30.5cm).
Mufla Programable
Cantidad: 1 (uno)
Camara interna 1.6 pie3 (36 x 36 x 36 cm)
Rango de temperatura 100 a 1000 °C (como minimo)
2 separadores (bandejas) refractarias
Capacidad para almacenar 4 prog de Temp,
con al menos 4 rampas de calentamiento.
2013.1
c4f_annexiitechspeciiitechoffer_es
Página 193 de 213
1.
2.
3.
4.
5.
Número
del
artículo
Especificaciones requeridas
Especificaciones ofrecidas
Notas, observaciones,
referencia a la
documentación
Notas del Comité
de Evaluación
89
Balanza Toploading
Cantidad: 1 (uno)
Rango de pesado de 0 a 320 gramos
Liniaridad 0.002
Sensibilidad 0,001g
Con tapa protectora
Con puerto std RS-232 para transferencia de datos a
impresor
Con impresor
LOTE 6 – EQUIPOS PARA ANALISIS DE BIOLOGÍA MOLECULAR
2013.1
c4f_annexiitechspeciiitechoffer_es
Página 194 de 213
1.
2.
3.
4.
5.
Número
del
artículo
Especificaciones requeridas
Especificaciones ofrecidas
Notas, observaciones,
referencia a la
documentación
Notas del Comité
de Evaluación
1
Estación de trabajo compacta para PCR
Cantidad: Uno (1)
 La estación de trabajo compacta para PCR debe
dirigir el aire filtrado (HEPA) hacia la superficie
de trabajo y proporcionar condiciones de trabajo
Clase 5. Proteger el trabajo de la contaminación
de partículas. El recinto debe contar con un
temporizador variable digital que ofrezca la
exposición de luz ultravioleta para neutralizar los
contaminantes de ADN y ARN.
 Dimensión de la estación: Profundidad de 27 a 29
pulgadas, ancho de 23 a 28 pulgadas, alto de 36 a
39 pulgadas
 Lámparas fluorescentes y lámpara UV 254 nm
con interruptor de tres posiciones (fluorescentes,
UV y apagado)
 Rango de apertura: 9,2 a 9,6 pulgadas.
 Angulo Ergonómico de 10 ° con bisagras hacia
arriba
 Filtros HEPA 99,99% de eficiencia.
 Difusor de aire
 Cambio de ventilador
 Superficie de trabajo tipo 304 acero inoxidable
pulido
 Revestimiento epóxico de aluminio y acero
 Cristal resistente a rayos UV.
 Requerimiento eléctrico: 115-120 voltios, 50/60
Hz
 GARANTÍA: 12 meses como minimo contra
defecto de manufactura y mal funcionamiento.
2013.1
c4f_annexiitechspeciiitechoffer_es
Página 195 de 213
1.
2.
3.
4.
5.
Número
del
artículo
Especificaciones requeridas
Especificaciones ofrecidas
Notas, observaciones,
referencia a la
documentación
Notas del Comité
de Evaluación
2
Equipo para reaccion en cadena de la polimerasa
(PCR) en tiempo Real
Cantidad: Uno (1)
 Sistema de ciclos térmicos Peltier.
 Bloque flexible para diferentes temperaturas,
conveniente para optimización de diferentes PCR
tiempo real.
 Formato del bloque de 96 pocillos
 Consumibles compatibles: Placas de 96 pocillos
(0.1 ml) con cubierta adhesiva óptica.
 Rango de volumen soportado: 10-30 ul.
 Frecuencia de rampa : Modo Rápido: menor de 3
° C / seg, Modo estándar: menor de 2 ° C / seg
 Rango de temperatura de 4 ° C-100 ° C
 Precisión de la temperatura menor de 0.3° C.
 Resolución de curva de fusión de 0,1 ° C
 Sistema óptico LED con 4 filtros como minimo.
 Colorantes calibrado FAM, SYBR Green I, VIC,
JOE, TAMRA, ROX
 Tiempo de corrida de un PCR cuantitativo: Modo
Rápido: menos de 40 minutos, Modo estándar:
menos de 2 horas. Pantalla táctil LCD
 Requerimiento eléctrico: 115-120 voltios, 50/60
Hz
 Debe incluir computadora.
 Software del sistema que incluya curva estándar,
curva estándar relativa, comparación de Ct ,
discriminación alélica (genotipo), curva de
fusión, Presencia / Ausencia. Software adicional
para una mejor resolución de la curva de
disociación o de fusión.
2013.1
c4f_annexiitechspeciiitechoffer_es
Página 196 de 213
1.
2.
3.
4.
5.
Número
del
artículo
Especificaciones requeridas
Especificaciones ofrecidas
Notas, observaciones,
referencia a la
documentación
Notas del Comité
de Evaluación
 Debe incluir entrenamiento en el uso del equipo
para 5 personas (local).
 Entrenamiento de aproximadamente 2 semanas, al
personal designado por la institución para la
utilización del equipo, garantizando su total
manejo operativo, avalado por un certificado de la
Empresa.

GARANTÍA:
12 meses de garantía como mínimo contra defecto de
manufactura y mal funcionamiento.
2013.1
c4f_annexiitechspeciiitechoffer_es
Página 197 de 213
1.
2.
3.
4.
5.
Número
del
artículo
Especificaciones requeridas
Especificaciones ofrecidas
Notas, observaciones,
referencia a la
documentación
Notas del Comité
de Evaluación
3
Termociclador para reaccion en cadena de la
polimerasa (PCR)
Cantidad: Uno (1)
 Termociclador para PCR con bloque flexible
peltier para 6 diferentes temperaturas conveniente
para optimizar PCR.
 Formato del bloque de 0,2 ml
 Las características estándar: bloque de 96
posiciones formato 0,2 ml y el bloque de la
muestra habilitado para ejecutar PCR rápidos
 Rampa de Velocidad del bloque max: 3.9ºC/ seg
 Rampa de Velocidad de la muestra max: 3.35ºC/
seg
 Precisión de la temperatura menor de 0,3ºC
 Rango de temperatura de 4,0 º C a 99,9º C
 Uniformidad de la temperatura < 0,5 ºC
 Rango de volumen del PCR:10-80 ul
 Pantalla táctil color, debe incluir calculador de
temperatura de fusión.
 Requerimiento eléctrico: 115-120 voltios, 50/60
Hz
 Garantía: 12 meses de garantía como minimo
contra defecto de manufactura y mal
funcionamiento.
2013.1
c4f_annexiitechspeciiitechoffer_es
Página 198 de 213
1.
2.
3.
4.
5.
Número
del
artículo
Especificaciones requeridas
Especificaciones ofrecidas
Notas, observaciones,
referencia a la
documentación
Notas del Comité
de Evaluación
4
Sistema para capturar imágenes de electroforesis
Cantidad: Uno (1)
 El sistema para capturar imágenes de
electroforesis debe de contener todos los
accesorios necesario detallados a continuación:
 Cámara digital: debe ser mayor de 12 megapixel
de resolución, imagen de color digital, conector
USB, conector de electricidad DC.
 Cuarto oscuro (Hood): Material plástico de peso
ligero con puerta de acceso al transiluminador,
con visor de geles, con tapa protectora de la
cámara a exposiciones ambientales.
 Filtros de emisión EtBr Red 570-640nm
 Transiluminador de alto rendimiento TFM-26
UV de 115-120 voltios, 50/60 Hz.
 Software: Control de la cámara, capturador de
imágenes compatibles con plataforma Windows.
GARANTÍA:
 12 meses de garantía como minimo contra
defecto de manufactura y mal funcionamiento.
2013.1
c4f_annexiitechspeciiitechoffer_es
Página 199 de 213
1.
2.
3.
4.
5.
Número
del
artículo
Especificaciones requeridas
Especificaciones ofrecidas
Notas, observaciones,
referencia a la
documentación
Notas del Comité
de Evaluación
5
Sistema para electroforesis horizontal de minigeles
Cantidad: Uno (1)
 La bandeja y la caja del gel deben ser moldeadas
con acrílicos para evitar fugas del líquido. La
bandeja debe ser transparente a los rayos
ultravioletas. Debe incluir electrodos de platinum
resistentes a corrosión
 Bandeja del gel de 10 x 10 cm.
 2 peines de 10 dientes
 Rango del volumen de buffer: 250 a 400 ml.
GARANTÍA:
 12 meses de garantía como minimo contra
defecto de manufactura y mal funcionamiento.
6
Sistema para electroforesis horizontal de midigeles
Cantidad: Dos (2)
 La bandeja y la caja del gel deben ser moldeadas
con acrílicos para evitar fugas del líquido. La
bandeja debe ser transparente a los rayos
ultravioletas. Debe incluir electrodos de platinum
resistentes a corrosión
 Bandeja del gel de 15 x 10 cm.
 1 peine de 16 dientes
 2 peines de 20 dientes
 Rango del volumen de buffer: 400 a 800 ml
GARANTÍA:
 12 meses de garantía como minimo contra
defecto de manufactura y mal funcionamiento.
2013.1
c4f_annexiitechspeciiitechoffer_es
Página 200 de 213
1.
2.
3.
4.
5.
Número
del
artículo
Especificaciones requeridas
Especificaciones ofrecidas
Notas, observaciones,
referencia a la
documentación
Notas del Comité
de Evaluación
7
Fuente de poder para electroforesis
Cantidad: Uno (1)





Fuente de poder útil para un amplio rango de
aplicaciones incluyendo separación de DNA,
RNA, y proteínas
Rango de salida de corriente: 4-500 mA
Rango de salida de poder: 90 W máximo
Rango de salida de voltaje: 2-300 V.
Requerimiento eléctrico: 115-120 voltios,
50/60 Hz
GARANTÍA:

12 meses de garantía como minimo contra
defecto de manufactura y mal
funcionamiento.
2013.1
c4f_annexiitechspeciiitechoffer_es
Página 201 de 213
1.
2.
3.
4.
5.
Número
del
artículo
Especificaciones requeridas
Especificaciones ofrecidas
Notas, observaciones,
referencia a la
documentación
Notas del Comité
de Evaluación
8
PCR-TIEMPO REAL
Cantidad: uno (1)
 Sistema de monitoreo en Línea.
 Equipo con bloque para placas 384 pozos, 40
ciclos: menos de 40 minutos. Equipo con bloque
para placas de 96 pozos: menos de 1 hora.
 Dimensiones: Ancho 57.4 cm, Altura 49.7 cm
Profundidad; 58.8 cm. Formato a base de
placas: que cuente con una unidad termocicladora en bloque intercambiable de placas
multipozos de 96 y 384 hoyos. Unidad termocicladora en bloque que se puede cambiar
rápidamente. Instrumento detecta e identifica
automáticamente al bloque. Lamina selladora de
placas.
 Termobase: permite la distribución homogénea
de la temperatura a lo largo de toda la placa.
 Tasa de calentamiento: 4.8 ºC/s; Tasa de
enfriamiento 2.5ºC/s.
 Control de temperatura: Calentamiento /
enfriamiento a base de peltier y elementos de
enfriamiento. Rango: 37 ºC - 95ºC. - Volumen
total de reacción 5-20ul en placas de 384 pozos y
10-100 ul en placas de 96 pozos.
 Filtros: Seis canales de emisión (500, 533, 568,
610, 640 y 670nm) ideal para canales miltiplex.
Cinco canales de excitación (450,483, 523, 558 y
670nm).
2013.1
c4f_annexiitechspeciiitechoffer_es
Página 202 de 213
1.
2.
3.
4.
5.
Número
del
artículo
Especificaciones requeridas
Especificaciones ofrecidas
Notas, observaciones,
referencia a la
documentación
Notas del Comité
de Evaluación
 Detector: Cámara CCD (charged couple device)
monocromática. permite la captura uniforme y
precisa a través de toda la placa independiente de
la posición de la muestra sin necesidad de
normalizar por señales fluorescentes.
 Capacidad de Utilizar Formatos de detección:
SYBR Green, ResoLight para relizar Gen
Scanning, Sondas de Hibridación, Sondas
TaqMan o de Hidrólisis, Sondas Simples.
Capacidad de realizar las siguientes aplicaciones
por medio del software:
Detección cualitativa de genes, Cuantificación
Absoluta y Relativa, Expresión Génica,
Tipificación Génica, Scanneo Genético (High
Resolution Melting). - Software en ambiente
Windows (Con interface intuitiva y amigable).
 Software modular para diferentes módulos de
análisis: Detección Cualitativa, Cuantificación
Absoluta mediante método automático de la
segunda
derivada,
Tm
calling
para
caracterización mediante curvas de melting,
Cuantificación relativa para expresión génica,
Gene Scanning, Genotyping para tipificación
génica por curvas de melting o sondad para
análisis de SNP.
 Cuantificación
de
Ácidos
Nucleídos,
Disponibilidad de consumibles y reactivos
Master Mixes de alta sensibilidad y calidad.
 Requerimiento eléctrico 110v 60HZ
2013.1
c4f_annexiitechspeciiitechoffer_es
Página 203 de 213
1.
2.
3.
4.
5.
Número
del
artículo
Especificaciones requeridas
Especificaciones ofrecidas
Notas, observaciones,
referencia a la
documentación
Notas del Comité
de Evaluación
GARANTIA
 12 meses de garantía como mínimo contra
defectos de manufactura y funcionamiento.
Durante el período de la garantía efectuar las
reparaciones, revisiones y sustitución de piezas
dañadas sin costo adicional para la institución.
 Equipo completamente nuevo, fabricado con
materiales de primera calidad.

INSTALACIÓN Y ENTRENAMIENTO
 El equipo será instalado en el Laboratorio de
Fitosanitario y se deberá demostrar su
funcionamiento con muestras de interés para el
laboratorio durante el curso de entrenamiento en
el mismo.
 Entrenamiento de aproximadamente 2 semanas, al
personal designado por la institución para la
utilización del equipo, garantizando su total
manejo operativo, avalado por un certificado de la
Empresa.
2013.1
c4f_annexiitechspeciiitechoffer_es
Página 204 de 213
1.
2.
3.
4.
5.
Número
del
artículo
Especificaciones requeridas
Especificaciones ofrecidas
Notas, observaciones,
referencia a la
documentación
Notas del Comité
de Evaluación
9
ELECTROPHORESIS SISTEMAS
HORIZONTAL CON FUENTE DE PODER
Cantidad: Uno (1)
 Diseñado para múltiples y simultáneos recorridos
cortos. Permite sumergir el gel y recirculación de
buffer, los puertos permiten un fácil
mantenimiento y reducir cambios de buffer.
 El electrodo de platino debe estar protegido del
buffer y proporcionar un campo uniforme en todo
el ancho del gel.
 El gel UV transparente en bandeja es de 6mm
(1/4") de espesor, evitando distorsiones de cabeza
durante la aplicación de agarosa caliente.
 Dimensiones de la bandeja Gel: cm (Pl): 20 x
40 (7 ⅞ x 15 ¾).
 Dimensiones de la fuente de Poder: 20.3 W x
13.3 D x 11.4H(8 x 5¼ x 4 ½), Capacidad de
peso 3.2 kg (7lbs)
 Requerimiento eléctrico de 110 60 Hz.
GARANTÍA:
12 Meses de garantía contra defectos de manufactura
y funcionamiento. Durante el período de la garantía
efectuar las reparaciones, revisiones y sustitución de
piezas dañadas sin costo adicional para la institución.
INSTALACIÓN Y ENTRENAMIENTO

El equipo será instalado en el Laboratorio
Fitosanitario y se deberá demostrar su
funcionamiento con muestras de interés para el
laboratorio durante el curso de entrenamiento en
el mismo.
2013.1
c4f_annexiitechspeciiitechoffer_es
 Entrenamiento de aproximadamente 2 semanas, al
personal designado por la institución para la
utilización del equipo, garantizando su total
manejo operativo, avalado por un certificado de la
Página 205 de 213
1.
2.
3.
4.
5.
Número
del
artículo
Especificaciones requeridas
Especificaciones ofrecidas
Notas, observaciones,
referencia a la
documentación
Notas del Comité
de Evaluación
10
MagNA Lyser CIF
Cantidad: Uno (1)
 Equipo de mesa. Homogeneizador de muestras y
tejido de maceración mecánica utilizando
partículas de cerámica y solución buffers.
 Capacidad de homogenizar como mínimo 16
muestras al mismo tiempo.
 Capacidad no solo de utilizar protocolos
preestablecidos por la fábrica sino también
protocolos optimizados por el usuario.
 Capacidad de programar los tiempos de
maceración en rangos de 10 a 100 segundos,
programable en incrementos de 1 segundo como
mínimo.
 Velocidad de maceración entre 2000 - 7000 rpm,
programable a 100rpm como mínimo.
Dimensiones: 300mm de alturas, 320mm de
ancho y 400mm de profundidad.
 Debe contener indicadores luminosos para el
funcionamiento: un Indicador luminoso que
indique si el equipo está abierto y otro si el
equipo puede empezar o parar su funcionamiento.
 Rotor para muestras de acero inoxidable.
 Rotor de muestras removible para limpiarlo sin
problemas. Con plato de aluminio removible para
asegurar muestras en el proceso de maceración.
Con palanca de emergencia para abrir la tapa del
instrumento. Calidad y tipo de Muestras:
2013.1
c4f_annexiitechspeciiitechoffer_es
Página 206 de 213
1.
2.
3.
4.
5.
Número
del
artículo
Especificaciones requeridas
Especificaciones ofrecidas
Notas, observaciones,
referencia a la
documentación
Notas del Comité
de Evaluación
 El equipo debe traer bloque de enfriamiento de
muestras de mesa para evitar degradación de
ácidos nucleídos.
 Requerimiento eléctrico 110v- 60HZ
GARANTIA
 12 Meses de garantía como mínimo contra
defectos de manufactura y funcionamiento.
Durante el período de la garantía efectuar las
reparaciones, revisiones y sustitución de piezas
dañadas sin costo adicional para la institución.
 Equipo completamente nuevo, fabricado con
materiales de primera calidad.

INSTALACIÓN Y ENTRENAMIENTO
 El equipo será instalado en el Laboratorio de
Fitosanitario y se deberá demostrar su
funcionamiento con muestras de interés para el
laboratorio durante el curso de entrenamiento en
el mismo.
 Entrenamiento de aproximadamente 2 semanas, al
personal designado por la institución para la
utilización del equipo, garantizando su total
manejo operativo, avalado por un certificado de la
Empresa.
 debe ser como mínimo de 3 semanas.
2013.1
c4f_annexiitechspeciiitechoffer_es
Página 207 de 213
1.
2.
3.
4.
5.
Número
del
artículo
Especificaciones requeridas
Especificaciones ofrecidas
Notas, observaciones,
referencia a la
documentación
Notas del Comité
de Evaluación
11
MagNa Pure
Cantidad: Uno (1)
 Sistema para extracción de ácidos nucleídos
totalmente automatizado debe ser de mesa.
Extracción por partículas magnéticas.
 Capacidad de procesar como mínimo 32 muestras
simultaneas.
 Equipo con pantalla táctil incorporada.
 Dimensiones: No debe sobrepasar, 110cm ancho,
Altura 95 cm, profundidad 80cm.
 Equipo con detector de coágulos y sensor de
pérdida de puntas Tiempo requerido para realizar
la extracción de 32 muestras simultáneamente
debe ser entre 50 a 180 minutos.
 Debe poder conectarse al sistema de información
de Laboratorio.
 Debe tener como mínimo 2 filtros HEPA. Luz
ultravioleta interna para realizar ciclos de
esterilización. Sólidos y líquidos deben
descartarse en contenedores separados.
 El equipo debe usar puntas con filtro, para evitar
la formación de aerosoles.
 Debe cerrarse por completo durante el
procesamiento.
 Debe tener una unidad refrigerada.
 Debe funcionar posterior a la extracción, como
robot para el montaje de reactivos para la PCR.
 Capacidad de dispensar estos reactivos junto con
las muestras extraídas en placas de 96 hoyos
como tubos de reacción.
2013.1
c4f_annexiitechspeciiitechoffer_es
Página 208 de 213
1.
2.
3.
4.
5.
Número
del
artículo
Especificaciones requeridas
Especificaciones ofrecidas
Notas, observaciones,
referencia a la
documentación
Notas del Comité
de Evaluación
 Capacidad de extraer como mínimo ADN
genómico y bacteriano, ARN total, ADN/ARN
Viral Capacidad de procesar muestras de tejido
congelado, tejido parafinado, cultivo celulares,
bacterias, virus y plantas.
 Requerimiento Electrico 110v – 60HZ
GARANTIA
 12 meses de garantía como mínimo contra
defectos de manufactura y funcionamiento.
Durante el período de la garantía efectuar las
reparaciones, revisiones y sustitución de piezas
dañadas sin costo adicional para la institución.
 Equipo completamente nuevo, fabricado con
materiales de primera calidad.

INSTALACIÓN Y ENTRENAMIENTO
 El equipo será instalado en el Laboratorio de
Fitosanitario y se deberá demostrar su
funcionamiento con muestras de interés para el
laboratorio durante el curso de entrenamiento en
el mismo.
 Entrenamiento de aproximadamente 2 semanas, al
personal designado por la institución para la
utilización del equipo, garantizando su total
manejo operativo, avalado por un certificado de la
Empresa.
2013.1
c4f_annexiitechspeciiitechoffer_es
Página 209 de 213
1.
2.
3.
4.
5.
Número
del
artículo
Especificaciones requeridas
Especificaciones ofrecidas
Notas, observaciones,
referencia a la
documentación
Notas del Comité
de Evaluación
12
REACTIVOS BIOLOGÍA MOLECULAR
(PUESTA EN MARCHA BIOLOGÍA
MOLECULAR)
Reactivo
Presentación
Tampón de extracción(Kit Extracción
ADN, Qiagen DNeasy Plan Mini kit)
Buffer 10X
dNTPs mM
MgCl2
Cebadores=
HLBas
f:
TCGAGCGCGTATGCAATACG
Cebadores=
HLB
r:
GCGTTATCCCGTAGAAAAAGGTAG
TaqMan MGBProbe 4316034 56FAMAGACGGGTGAGTAACGC/G3NFQ
TaqMan Universal PCR Mix
Agua bidestilada estéril
250 xrns
Cantidad
/2000muestras
4
Kit de reacciones 1000U
Kit # R0192
50mM
10,000pmol
1
160g.
5ml
156 µl
10,000pmol
156156 µl
6,000pmoles
2
Mix
Libre de Nucleasas
(grado
biología
molecular)
Kit
Polyvinylpyrrolidone
27 ml
3 frascos
Taq DNA polimerasa
PVP10K
4
1,28g
Cantidad: 1 (uno)












Reactivos para PCR- tiempo real para el
diagnóstico de huanglongbing
Tampón de extracción
Buffer 10X 4
dNTP 5 mM
MgCl2 50 mM
CebadorA2 (100 μM)
Cebador J5 (100 μM)
Cebador GB1 (100 μM)
Cebador GB3 (100 μM)
Água bidestilada estéril
DNA genômico (500 ng/uL)
Taq DNA polimerasa
2013.1
c4f_annexiitechspeciiitechoffer_es
Página 210 de 213
1.
2.
3.
4.
5.
Número
del
artículo
Especificaciones requeridas
Especificaciones ofrecidas
Notas, observaciones,
referencia a la
documentación
Notas del Comité
de Evaluación
13
Thermociclador
Cantidad: Uno (1)











Gradiente ep: plato de 96 pocillos
Bloque de aluminio,
Rango de control de temperatura: 4º a 99º C
Rango de gradiente: 10 a 20º C
Uniformidad de la temperatura a 96º C: ≤±0.4º C
/ de 20º a 72º C: ≤±0.3º C
Control de exactitud: ±0.2º C
Velocidad de calentamiento: =4.5º C/segundo
Velocidad de enfriamiento: =3º C/segundo
No. de programas: >700 en el panel de control e
infinitos en tarjeta multimedia
Dimensiones: L x W x H 41.7 x 26.4 x 31cm
Requerimiento eléctrico: 115V 50/60Hz
GARANTÍA:





12 meses de garantía como mínimo contra
defectos de manufactura y funcionamiento.
Durante el periodo de la garantía efectuar las
reparaciones, revisiones y sustitución de piezas
dañadas sin costo adicional.
Equipo completamente nuevo, fabricado con
materiales de primera calidad.
De preferencia que tenga soporte técnico en el
país, inventario de repuestos básicos y personal
técnico capacitado
Garantía de repuestos de al menos 5 años,
después de descontinuada su fabricación.
Manual de usuario en idioma español
preferiblemente.
2013.1
c4f_annexiitechspeciiitechoffer_es
Página 211 de 213
1.
2.
3.
4.
5.
Número
del
artículo
Especificaciones requeridas
Especificaciones ofrecidas
Notas, observaciones,
referencia a la
documentación
Notas del Comité
de Evaluación
14
Cámara Electroforesis con sus accesorios
Cantidad: 4 (cuatro)
Capacidad: 300 ml
Capacidad máxima de muestras 10
Dimensiones: 12.5W x 22L x 9H cm
Con sus accesorios:
Gradilla para gel 10 x 10 cm
Casting Dam 89030-942 (Paquete de 2)
Garantía:
 12 meses de garantía como mínimo contra
defectos de manufactura y funcionamiento..
 Equipo completamente nuevo, fabricado con
materiales de primera calidad.
 Garantía de repuestos de al menos 5 años,
después de descontinuada su fabricación.
 Manual de usuario en idioma español
preferiblemente.
2013.1
c4f_annexiitechspeciiitechoffer_es
Página 212 de 213
1.
2.
3.
4.
5.
Número
del
artículo
Especificaciones requeridas
Especificaciones ofrecidas
Notas, observaciones,
referencia a la
documentación
Notas del Comité
de Evaluación
15
Cámara digital Registro geles
Cantidad: 1 (uno)
Sensor CCD 8.0 Megapix
Zoon 15x
Adaptador a rosca para lentes de conversión
Conexión
Compatible con tarjeta X
Garantía:
 1 año de garantía como mínimo contra defectos
de manufactura y funcionamiento..
 Equipo completamente nuevo, fabricado con
materiales de primera calidad.
 Manual de usuario en idioma español
preferiblemente.
REQUISITOS GENERALES PARA LOS CERTIFICADOS DE CALIBRACIÓN:
1. Los laboratorios que realicen las calibraciones y emitan los certificados de los instrumentos deben de ser Laboratorios primarios
(NMI) con mejores capacidades de calibración (CMC) reconocidas por el BIPM
2. El laboratorio que certifica debe cumplir con todos los requisitos para laboratorios de calibración de la norma ISO/IEC 17025:2005
“General requirements for the competence of testing and calibration laboratories” o de la Norma Técnica Obligatoria Nicaragüense NTN
04 009– 05 “Requisitos Generales para la Competencia de Laboratorios de Ensayo y de Calibración”
3. Todos los certificados de calibración deben ser destinados a nombre del Laboratorio Nacional de Metrología (LANAMET) con los
requisitos expuestos en el ítem anterior.
4. Los certificados deben venir con fechas de calibración como máximo cuatro (4) meses posterior a su calibración.
2013.1
c4f_annexiitechspeciiitechoffer_es
Página 213 de 213
Descargar