Genética molecular - Colegio La Inmaculada, Camponaraya

advertisement
Biología . 2º Bachillerato Colegio “La Inmaculada”
Genética molecular
1 - La información celular
1.0 - Información
1.1 - Flujo de información el la célula
1.2 - Replicación
1.3 - Transcripción
1.4 - Traducción
1.5 - Amplificación génica
1.6 - Genes
1.7 - Diferencias procariotas y eucariotas
1.0 - Información
Información - Mensaje que se transmite






Necesita una variedad o código que tiene un significado.
Los códigos pueden ser lineales (morse, sonidos de las palabras, datos digitales de ordenadores, código genético...)
superficies (letras ...) o tridimensionales.
Los códigos pueden convertirse de unos en otros mediante claves de conversión:
Por ejemplo un código digital ASCII el código 01000001 (65) corresponde a la letra A, el grafismo A lo interpreta nuestro
cerebro con el sonido A, este sonido se interpreta como un fonema, una lista de fonemas se interpreta como palabra ....
Los códigos pueden ser :
o Arbitrarios: No tiene nada que ver el símbolo con el significado
o Naturales: El símbolo tiene alguna relación con el significado
o Intermedio
Los códigos tienen que tener una variedad de elementos; al menos dos formas diferentes pero pueden ser más.
Por ejemplo el código binario (0,1), hexadecimal (0,...16), Alfabeto (a...z)
La información se almacena en soportes de apariencia monótona con una estructura que lo soporta y con una variedad
repetida numerosas veces
Libro, cinta, DVD, ADN, voz: (Si no somos capaces de descifrarlos nos parecen muy monótonas)
Las células tienen que tener instrucciones de cómo funcionar y desarrollarse.
Esta información está codificada en los ácidos nucleicos.
Debre trasmitirse para formar proteínas que desarrollan las estructuras y funciones declulares
2.1.1 - Flujo de información de la célula
En la célula ha de haber almacenada algún tipo de información para su constitución, funcionamiento y reproducción
Esta información se encuentra en la variedad en los componentes de una molécula; el ADN
La información ha de expresarse
Las responsables de las características celulares son las proteínas
Existe un intermedio entre ADN y Proteínas: los ARN
Las moléculas se crean con la información aportada por otras
Esta información consiste en el orden (secuencia) de sus componentes

ADN
Guarda información genética en la secuencia de sus 4 bases
Las bases se encuentran protegidas en el interior de la doble hálice.Es una molécula más estable que ARN al carecer de
un grupo alcohol la desoxirribosa.
La información del ADN puede copiarse con ayuda de proteínas: Replicación
La información del ADN puede trasferirse al ARN con ayuda de proteínas : Transcripción

ARN
Intermediario en la síntesis de proteínas
Su función realizar la síntesis de proteínas con los aminoácidos en una determinada secuencia.

Proteínas
Dan lugar directa o indirectamente a las funciones y estructuras celulares
Responsables de la síntesis, localización y funcionamiento del resto de los componentes celulares.
Volver
1.2 - Replicación
Proceso por el cual una molécula de ADN se copia; duplica su información
Este proceso parte de una hebra de ADN y genera una hebra complementaria
La replicación es semiconservativa: Cada hebra genera una complementaria nueva
Es realizada por proteínas
Necesita:







dNTP (dATP, dGTP, dCTP, dTTP)
ADN Molde
Enzima ADN Polimerasa (3 tipos en procariontas y 5 en eucariontas)
Ver ADN pol
Helicasa (Desenrrollasa)
Topoisomerasas (girasa)
Ligasas
Proteínas reparadoras de errores (ADN pol reparadoras y otras 50 proteínas)
El enzima que reliza la replicación es la ADN polimerasa.
Tiene unos 1000 aa con lugares para ADN molde, cebador (ARN o ADN ya
formado) y dNTP.
Genera una hebra de ADN complementario que crece de 5´a 3´




ADN pol se une a una hebra de ADN molde
Busca un desoxirribonucleótido trifosfato complementario al de la base del
ADN situda en el sitio del dNTP
Lo une a la cadena de desoxirribonucleótidos anterior
Avanza una posición y repite el proceso indefinidamente
ADN plimerasa
Una cadena crece más rápido por ser posible avanzar en el sentido 5->3´de manera continua, mientras que la otra debe
interrumpirse y volver a comenzar
En realidad el proceso es más complejo que el descrito puesto que la ADN pol nunca inicia la síntesis de ADN a partir de una
cadena sencilla de ADN sino que necesita un híbrido de ADN-ARN (primer) de doble cadena para comenzar. Este híbrido es
generado por la ARN polimerasa (primasa). Tras la replicación ha de eliminarse el ARN, sustituirse por ADN y unir la cadena.
Orígenes de replicación
Cuando las células comienzan a replicar el ADN continúan hasta haberlo copiado completamente. (Replicación en bacteria y fase
S del ciclo celular de eucariontes)


Los procariontes tiene un solo sitio de inicio de la replicación en su cromosoma.
El proceso avanza a unas 16.000 pb/min
La replicación se completa en pocos minutos
Los eucariontes tienen miles de sitios de inicio de replicación (En humanos unos 30.000)
El proceso avanza más lentamente; a unas 2.600 pb/min.
Esto es debido a la estructura más compleja de los cromosomas con ADN ligado a histonas y otras proteínas.
La replicación tarda más tiempo en completarse
Corrección de errores
Para las células es importante copiar el ADN con el menor número posible de errores.

La ADN pol comete un error por cada millón de nucleótidos ligados. 1/E6


Existe un primer proceso de autocorreción en la ADN pol que comprueba el apareamiento de bases.
Reduce la tasa a 1/E8
Luego actúa un proceso de corrección postreplicativa que detecta las bases no apareadasy la cadena original.
Los enzimas de la corrección eliminan los nucleótidos de la nueva cadena e introducen los complementarios de la cadena
original correctamente.
La tasa de error se reduce a 1/E10.
La tasa de errores en la replicación crece con determinadas sustancias químicas que emulan a los nucleótidos o que interfieren en
los enzimas reparadores
La tasa de errores es mayor en células que tienen genéticamente dañados los genes reparadores.
En estos casos aumenta la tasa de mutación celular
2.1.3 - Transcripción
Proceso por el cual una molécula de ADN pasa la información a una molécula de ARN
En la trascripcion un ADN genera un ARN complementario
Solo se trascribe una hebra del ADN
Solo se trascribe un fragmento de la hebra, no la hebra entera
El ADN permanece inalterado al final del proceso
La trascripción es realizada por proteínas. El enzima principal es la ARN polimerasa
Necesita:




NTP (ATP, GTP, CTP, TTP)
ADN Molde
Se denomina hebra informativa del ADN a la que no se trascribre y
herbra molde la que si lo hace
Enzima ARN Polimerasa (ADN dependiente)
Con lugares para códigos de fin, ADN molde y NTP.
Ver ARN pol
Proteínas de reconocimiento de las secuencias de inicio o de activación
Estructura tridimensional de la ARN polimerasa



Señal de comienzo de la trascripción accesible en el ADN: Promotor
Se encuentra en la hebra informativa en sectores codificadores anteriores al comienzo de la trascripción. (10 -120)
La secuencia del promotor suele ser TTGACA...TATAAT en procariontes y CAAT...TATA en eucariontes
Señal de final en el ADN
Secuencia palindrómica que suele ser Poli GC en seguido de TTATTT o TTTTT
En ocasiones puede haber secuencias potenciadoras o silenciadoras de la trascripción anteriores al
promotor (-200, -1000)
La trascripción avanza en el sentido 3'->5´de la hebra molde de ADN
La cadena de ARN creada crece en sentido 5´-> 3´
Proceso de trascripción
Inicio




Proteínas de reconocimiento se unen al promotor en
el ADN
Se abre la hebra de ADN.
ARN pol se sitúa en la hebra molde
Introduce un nucleótidos trifosfato complementarios al
del ADN
Elongación




Avanza una posición
Introduce un nucleótidos trifosfato complementarios al
del ADN en la nueva posición
Une el núcleótido introducido al anterior mediante un
enlace ester del ácido fosfórico liberando pirofosfato
El proceso se repite indefinidamente hasta encontrar
una secuencia de fin
.
.
Finalización

ARN pol reconoce la secuencia de fin y se libera al ARN formado
La velocidad de síntesis de la ARN pol de bacterias es de unos 40 nucleótidos/s
ARN formado va separándose según se sintetiza y el ADN vuelve a enrrollarse
Una misma hebra molde puede ser trascrita por varias ARN pol simultáneamente estando cada una de ellas a una distancia del
origen y con un progreso en la trsacripcción diferente.
En procariontes hay solo una ARNpol, en eucariontes hay varias una para cada tipo de ARN
Video sobre trascripción
Tratamiento post-transcripcción de los ARN
ARNm
En células eucariotas. Se realiza en el núcleo celular
Se añade una cola poli-A en 3´. Unos 300 restos.
Una caperuza metilGTP invertida en 5´ (Se realiza mientras se transcribe)
Generalmente se eliminan restos del ARN (intrones) y se enpalman los que si codifican para proteína (exones) dejando un ARNm
maduro de menor longitud
Algunos ARN pueden dar proteínas diferentes eliminando intrones diferentes
ARNr
Se sintetiza un único ARN
Se divide por enzimas. Tres 4? fragmentos útiles
ARNt
Disminución de tamaño. Modificación de bases
Restos de ARN y ARN no traducido sirven para la regulación genética
1.4 - Traducción
Proceso por el cual una molécula de ARNm proporciona información para la secuencia de una proteína.
Es un proceso mucho más complejo que la replicación y trascripción porque se ha de pasar de un códogo de 4 nucleótidos a uno
de 20 aminoácidos.
Necesita:








Aminoácidos (20 moléculas)
ARNt (unos 80 tipos de ARNt. mínimo 61)
Aminoacil ARNt sintetasa
(unas 40 enzimas. mínimo 20)
Subunidad mayor del ribosoma
Subunidad menor del ribosoma
ARNm
GTP (fuente de energía para el proceso)
Otros factores reguladores
Proceso
Se suelen distinguir cuatro fases: Activación, Iniciación, Elongación y Finalización
Activación



Aminoacil ARNt sintetasa liga específicamente un ARNt a un
aminoácido con consumo de ATP
La unión es mediante el grupo carboxilo del aa al alcohol libre
en 3´ del ARNt
El enzima aminoacil ARNt sintetasa queda inalterada para
una nueva unión
Existen varios ARNt posibles para cada aa. Pero núnca dos
aminoácidos diferentes se unen a un mismo tipo de ARNt
Iniciación






Unión de la subunidad menor del ribosoma al ARNm en 5´ (secuencia o caperuza).
Consumo de una molécula de GTP
Avance en sentido 5´->3´hasta encontrar el codon de iniciación AUG
Unión al ARNt-aa (ART-Met) complemtario (Anticodon CAU) que corresponde a la metionina (formilmetionina en proc)
Unión de la subunidad mayor del ribosoma
Paso del sitio aminoacídico (A) al sitio peptídico (P); avance de tres nucleótidos
Elongación





Lectura del nuevo codon en el sitio A
Entrada del ARNt-aa complemantario
Unión del péptido anterior al actual con cosumo de GTP. Grupo carboxilo reaccionacon amino formando el enlace
peptídico
Se liberación del ARNt (sin aminoácido) del sitio P
Paso del ARNt-pep del sitio A al sitio P
Repetición de este proceso hasta codon de finalización
Finalización




El sitio A se encuentra con un código de finalización: UAA UAG UGA
Proteína ribosómica impide que entre ningún ARNt-aa
Se realiza una hidrolisis del carboxilo del ARNt-pep con gasto de GTP liberando la cadena polipeptídica y el ARNt
Se separan el ARNm, y las dos subunidades del ribosoma.
Tratamiento Post- traducción
En muchas proteínas se producen modificaciones tras la traducción:






Eliminación de la metionina inicial de la cadena polipeptídica
Plegamiento correcto mediante proteínas específicas : Chaperonas
Establecimiento de puentes bisulfuro entre cisteínas (enzimas específicos)
Unión a otras sustancias. Heteroproteínas
Modificación de aminoácidos
Cortes en cadenas
Balance de la traducción



Se consumen aminoácidos y GTP (4 unidades por aminoácido, 2 en activación y 2 en elongación más otras en el conjunto
del proceso)
Se producen polipéptidos (péptidos o proteínas) y GDP+Pi
Se regeneran las macromoléculas implicadas (ARNm, ARNt, Subunidades del ribosoma) que pueden usarse para nuevas
síntesis proteínicas
Lugar
En procariotas se realiza en el citoplasma
En eucariotas va a depender de la secuencia inicial de la síntesis, en citoplasma o RER
Código genético
Correspondencia existente entre los nucleótidos de ARNm y los aminoácidos en la síntesis de proteínas
Tiene una serie de peculiaridades:






Es unidireccional
Se lee siempre de 5´a 3´
Carece de solapamientos y espacios
Todas las bases se leen a partir del código de
inicio.
No es ambiguo
Cada triplete tiene una información única
Es universal
Todos los seres vivos comparten el mismo
código genético
(Hay pequeñas excepciones en genomas de
organismos sencillos y orgánulos celulares)
Es arbitrario
No relación directa entre los aminoácidos y
tripletes que codifican para ellos
La universalidad de un código arbitrario es una
prueba del de origen único de todoas los seres
vivos actuales
Es degenerado
Frecuentemente varios tripletes codifican para
el mismo aminoácido. La tercera base del
anticodon es menos importante que las dos
primeras.
Parecen ser una ampliación de un código
Código Genético
Correspondencia entre las bases de 5´-> 3´en ARNm . (Codones) con Aminoácidos
A**
G**
C**
U**
AAA
Lys
GAA
Glu
CAA
Gln
UAA
AAG
Lys
GAG
Glu
CAG
Gln
UAG
AAC
Asn
GAC
Asp
CAC
His
UAC
Tyr
AAU
Asn
GAU
Asp
CAU
His
UAU
Tyr
AGA
Arg
GGA
Gly
CGA
Arg
UGA
AGG
Arg
GGG
Gly
CGG
Arg
UGG
Trp
AGC
Ser
GGC
Gly
CGC
Arg
UGC
Cys
AGU
Ser
GGU
Gly
CGU
Arg
UGU
Cys
ACA
Thr
GCA
Ala
CCA
Pro
UCA
Ser
ACG
Thr
GCG
Ala
CCG
Pro
UCG
Ser
ACC
Thr
GCC
Ala
CCC
Pro
UCC
Ser
ACU
Thr
GCU
Ala
CCU
Pro
UCU
Ser
AUA
Ile
GUA
Val
CUA
Leu
UUA
Leu
AUG
Met *
GUG
Val
CUG
Leu
UUG
Leu
AUC
Ile
GUC
Val
CUC
Leu
UUC
Phe
*A*
*G*
*C*
*U*
ancestral de dos bases
AUU
Ile
GUU
Val
CUU
Leu
UUU
Phe
Codones de cada aminoácido
Aminoácido
Los aminoácidos tienen desde un solo triplete (Met,trp) a 6 (Arg,Leu,Ser)
La última base menos importante. Resto de un código con dos bases o
menor afinidad
Sentidos de la transcripción y traducción


ARNpol avanza en el ADN de 3´a 5´
ARN en formación crece de 5´a 3´
Lo hace desde una secuencia de inicio de transcripción hasta una
secuencia de fin
Traducción avanza el ARNm de 5´a 3´
Los aminoácidos se unen del amino a carboxilo terminal
Se realiza desde la secuencia de inicio AUG, leyéndose tripletes
hasta encontrar uno de fin UAA, UAG, UGA
Un mismo ARNm puede llevar varios inicios (virus)
Codones
Gly
4
GGA GGG GGC GGU
Ala
4
GCA GCG GCC GCU
Val
4
GUA GUG GUC GUU
Leu
6
CUA CUG CUC CUU UUA UUG
Ile
3
AUA AUC AUU
Met
1
AUG
Cys
2
UGC UGU
Ser
6
AGC AGU UCA UCG UCC UCU
Thr
4
GCA GCG GCC GCU
Asp
2
CAC CAU
Glu
2
CAA CAG
Lys
2
AAA AAG
Arg
6
AGA AGG
Asn
2
AAC AAU
Gln
2
CAA CAG
Phe
2
UUC UUU
Tyr
2
UAC UAU
His
2
CAC CAU
Trp
1
UGG
Pro
4
CCA CCG CCC CCU
Final
3
UAA UAG UGA
Ejemplo
Este es un ejemplo de la proteína que codificaría un fragmento de ADN de doble cadena.
Supóngase que la secuencia de iniciación de la ARNpol es 3´ TTATT 5' y la secuencia de fin 3´ AATAT 5´
El ejemplo no es totalmente real pues las secuencias de incicio de trascripción y traducción son más complejas que las apuntadas.
ADN hebra 1
*
5´
AATGGTATAATAAAGATGCTTAGTGGGCAGACATAAGATTATTTATATAA
3´
3´
TTACCATATTATTTCTACGAATCACCCGTCTGTATTCTAATAAATATATT
5´
ADN hebra 2
Lectura de la hebra 1
ADN hebra 1
Fin
5´
Inicio
AATGGTATAA T AAAGATGCTTAGTGGGCAGACATAAGATTATTTATATAA
3´
A UUUCUACGAAUCACCCGUCUGUAUUCU
3´
5´
ARNm 1
ARNm 1
Inicio
5´
Fin
U CUUAUGUCUGCCCACUAAGCAUCUUUAAAAAAAAAAAAA
Met
Ser
Ala
3´
His
Péptido 1
Lectura de la hebra 2
ADN hebra 2
Inicio
3´
Fin
TTACCATATTATTTCTACGAATCACCCGTCTGTATTCTAATAAATATATT
5´
GAUGCUUAGUGGGCAGACAUAAGAUUAU
3´
ARNm 2
ARNm 2
Inicio
5´
Fin
GAUGCUUAGUGGGCAGACAUAAGAUUAUAAAAAAAA
Met
Leu
Ser
Gli
Gln
Thr
Péptido 2
¿Qué efecto tendría una mutación en la base 15 del ADN marcada con * una G por la C?
3´
5´
1.5 - Amplificación génica
Un solo fragmento (gen) en un ADN tiene que tener efectos en una célula entera o en un organismo
Esto requiere un proceso de de amplificación muy importante. La información ha de ampliarse enormemente para que se exprese
en una célula o en un organismo
Los principales procesos que consiguen esto son:



Un gen en el ADN se puede leer un número ilimitado de veces produciendo cientos ARNm con la misma secuencia
Cada ARNm al traducirse produce varias proteínas idénticas antes de ser destruído por ARNasas celulares
Se pueden producir miles de proteínas. Depende de los ritmos de transcripción, traducción y degradación de proteínas
El ritmo de síntesis es regulado por procesos de retroalimentación negativa
Las proteínas pueden catalizar reacciones químicas o trasportar sustancias.
Cada proteína puede realizar cientos o miles de veces esta operación por segundo
1.6 - Genes
Inicialmente definidos como factores hereditarios.
Posteriormente se los identificó con fragmentos de cromosomas
En los años 50 del pasado siglo se definieron como fragmentos de ADN que codifican para proteínas: Una proteína un gen
Problemas con esta definición
- ARNt y ARNr no sintetizan proteínas y su alteración tiene consecuencias genéticas; por lo tanto tienen genes
- Las secuencias estructurales del ADN
- Secuencias de reconocimiento
- ARN regulador en eucariontes: Intrones, micro ARN
Por tanto desde el punto de vista de la biología molecular se puede hablar de varios tipos de genes:



Genes con transcripción y traducción: Información para Proteínas
Genes con transcripción sin traducción : ARNt . ARNr . Intrones . ARN interferente. Otros ARN eucariotas
Genes sin transcripción ni traducción: Secuencias marcadoras en ADN . Reguladoras y estructurales
Número de genes en las células
En número de genes que sintetizan para proteínas es variable en las células pero mucho menos de lo que sería esperable
atendiendo a su complejidad externa
Los números no tienen muchas veces que ver con la complejidad del organismo
Genoma y genes codificantes para proteína en procariotas y eucariotas típicos
ADN
Genes para
proteínas
Formación de
proteínas
Procariotas
Eucariotas
3E6 pb
3E9 pb (humanos)
Mayoría se transcribe en ARN
85% del genoma se trascribe en proteínas
Mucha secuencia no codificadora para proteínas
Del 30 al 99 % del ADN no se trascribe para proteínas
(Sólo 1,5% del genoma humano se transcribe en proteínas)
Mucho ADN se trascribe en ARN pero no se traduce sirve
como regulador (genes no proteínicos)
Unos 3.000 genes en ADN para proteínas
en bacterias típicas.
Mínimo 500 genes en bacterias más
simples
Protistas 6.000 - 10.000.
Animales 14.000 - 24.000 genes
Todos parecidos a pesar de sus diferencias
- Nematodo 19.000
- Insecto 14.000
- Vertebrados superiores y humanos 22.000
Plantas de 25.000 a 40.000
Genoma de algunos organismos
Células
Orgánulos
Virus
Otros
Organismo
Mycoplasma genitalium
Eschericia coli
Halobacterium NRC-1
Saccharomyces cerevisiae
Caenorhabditis elegans
Drosophila melanogaster
Danio rerio
Protopterus aethiopicus
Mus musculus
Homo sapiens
Arabidopsis thaliana
Oryza sativa
Zea maiz
Cebolla
Fritillaria assyriaca
Mitocondria humana
Influenza virus
VIH
Viroide
Trasposon
Taxón
Bacteria - Mycoplasma
Bacteria - Enterobacteria
Arquea Halófila
Hongo - Levadura
Animal - Nemátodo
Animal - Artrópodo - Insecto
Animal - Vertebrado - Osteictio
Animal - Vertebrado - Osteictio
Animal - Vertebrado - Mamífero
Animal - Vertebrado - Mamífero
Planta - Dicotiledonea - Crucífera
Planta - Dicotiledonea - Gramínea
Planta - Dicotiledonea - Gramínea
Planta - Monocotiledónea- Liliácea
Planta - Monocotiledónea- Liliácea
Virus de ARN
Virus
Genoma (pb)
Proteínas
580.000
4.640.000
2.600.000
12.068.000
97.000.000
180.000.000
1.700.000.000
140.000.000.000
2.600.000.000
3.200.000.000
118.000.000
430.000.000
15.000.000.000
120.000.000.000
16.569
9.800
200
5.000
500
4.300
2.333
6.200
19.500
13.600
22.000
.
21.000
21.000
25.500
60.000
40.000
.
13
11
15 ?
0
3
El mayor número de genes de organismos eucariotas y pluricelulares se supone que tiene que ver con la secreción de sustancias
y mecanismos de reconocimiento celular
Comparación del genoma de bacterias y levaduras
Genoma (pb)
Proteínas
Metabolismo
Energía almacenamiento
Trasporte membrana
Bacteria E.coli
Levadura S.cerevisiae
4.640.000
12.068.000
4.300
6.200
650
650
240
175
280
250
ADN: replicación, reparación,
recombinación
120
175
Trascripción
230
180
35
180
400
350
430
250
Traducción
Secreción
Estructurales
En estudios del genoma de organismos superiores se han encontrado numerosos genes fósiles que no se trascriben por
modificaciones en su secuencia de reconocimineto
También existen genomas víricos inactivos o latentes y otros entes genéticos como trasposones
Genes no celulares
Otros entes biológicos no celulares también poseen genes:



Virus
Plásmidos
Trasposones
Se estudiarán en el capítulo de virus
1.7 - Diferencias procariotas y eucariotas
Características genéticas
Procariotas
Eucariotas
Genes
para proteínas
No muchos 500-5.000
Muchos 4.000 - 30.000
Estructura
Continuos
Con intrones
ADN regulador
Escaso
Abundante
Estructura
Doble hélice libre
Raramente unido a proteínas
Doble hélice Asociado a Histona y PCNH.
Nucleosoma, solenoide, ....
Localización
En citoplasma
En el núcleo celular en interfase
Cromosomas
Cromosoma circular único
Varios cromosomas lineales
Pares de bases
E6 E7
E8 E11
Sec. repetidas
Pocas
Muchas
Velocidad
Rápida
Más lenta
Origen
Origen único
Origen múltiple; miles de sitios
ADN
Replicación
Transcripción
Traducción
Polimerasa
Un solo tipo de ARN polimerasa
Tres tipos de ARN polimerasa
ARNpolI –> ARNr
ARNpolII –> ARNm
ARNpolIII –> ARNt y otros
Lugar
En citoplasma
En núcleo
Velocidad
Rápida
Más lenta
Tipo de ribosoma
Ribosomas pequeños
Ribosomas mayores
Localización
En citoplasma libres o en polisomas
En citoplasma libres o ligados al REP
Descargar