MACHETE8Nucleo

advertisement
NUCLEO (interfásico)
La siguiente descripción del núcleo corresponde al momento del ciclo celular denominado
interfase (momento en que la célula no se divide). Cuando la célula entra en fase de división, el
núcleo experimenta grandes cambios.
Estructura
- Envoltura nuclear o carioteca: formada por dos membranas concéntricas, la membrana
interna (en contacto con el interior del núcleo) y la membrana externa (en contacto con el
citoplasma. Tiene ribosomas adheridos y una expansión de la misma da origen al REG).
Ambas membranas están separadas por el espacio perinuclear. La carioteca presenta
“perforaciones”: los complejos del poro, que permiten una comunicación entre núcleo y
citoplasma.
El transporte a través de los poros es, para la mayoría de las moléculas excepto las muy
pequeñas, un transporte activo (consume energía de GTP), mediado por proteínas y muy
selectivo.
Transporte citoplasma-núcleo: las moléculas a transportarse deben tener una señal que indique
que su destino es el interior del núcleo (NSL o señal de localización nuclear). Las proteínas
transportadoras son las importinas. Ejemplos de moléculas que se transportan desde
citoplasma hacia el núcleo son las histonas, proteínas ribosomales, enzimas de la duplicación
del ADN, enzimas de la transcripción.
Transporte núcleo-citoplasma: las moléculas a transportarse deben tener una señal que indique
que su destino es el citoplasma (NES o señal de exportación nuclear). Las proteínas
transportadoras son las exportinas. Ejemplos de moléculas que se transportan desde el núcleo
hacia el citoplasma: ARNm, ARNt.
- Lámina nuclear: red de filamentos proteicos (del tipo de filamentos intermedios) que está
adyacente a la membrana interna. Da soporte interno al núcleo y se relaciona con la
desorganización y reorganización de la carioteca al momento de la división celular.
-Nucleoplasma: sustancia que ocupa el uvespacio interno del núcleo y que contiene sustancias
disueltas (ribonucleótidos y desoxirribonucleótidos libres, etc.), la matriz nuclear
(esqueleto filamentoso que será soporte de cromosomas) y el ADN asociado a histonas.
-Nucleolo: es un área o sector dentro del núcleo en el cual se sintetizan algunos ARN
ribosomales que allí mismo se ensamblarán con proteínas ribosomales para formar las
subunidades ribosomales.
-Cromatina : asociación del ADN con histonas. Las histonas se agrupan en octámeros (ocho
moléculas de histonas), alrededor de las cuales se enrolla el ADN. A este conjunto se lo
denomina nucleosoma (unidad de la cromatina). La histona 1 no forma parte del nucleosoma
pero se le une.
histonas
Hay dos tipos de cromatina:
 Heterocromatina : es la más condensada y por ello no se transcribe.
 Eucromatina: es la que está en estado más laxo y es la que se transcribe.
Cuando la célula entra en división, se
producen una serie de cambios en la
cromatina. En forma relativamente
rápida la cromatina sufre una
condensación progresiva hasta
alcanzar el máximo grado de
compactación posible: el cromosoma.
Un cromosoma típico consta de un centrómero, dos cromátides hermanas y telómeros. Cada
cromátide es una molécula de ADN. Las dos cromátides hermanas de un cromosoma son dos
moléculas de ADN idénticas en cuanto a la información genética (originadas a partir de la
duplicación del ADN).
Los cromosomas pueden adoptar distintas morfologías según la posición del centrómero:
Cariotipo
Imagen gráfica o fotográfica de los cromosomas presentes en el núcleo de una célula somática
de un individuo. Esta imagen debe ser tomada en el momento en que los cromosomas sean
visibles (o sea al momento de la división, concretamente en la metafase que es el momento de
máxima condensación de la cromatina). En la imagen se presenta el cariotipo de una célula
humana (puntualmente de un varón dado que los cromosomas sexuales son X e Y). Hay 22
pares de autosomas (cromosomas que no son los sexuales) y un par de cromosomas
sexuales. Esto hace un total de 46 cromosomas (número típico de cromosomas en la especie
humana).
Par de cromosomas homólogos (aunque no se vea claramente
cada uno de estos cromosomas está formado por dos
cromátides)
TRANSCRIPCIÓN Y TRADUCCIÓN
Algunos conceptos centrales son:
GEN: secuencia de ADN que posee información y que transcribe para un producto celular con
función específica. Es la unidad informativa del ADN, responsable de una característica
transmisible.
GENOMA: conjunto de genes de una especie.
EXPRESIÓN GENÉTICA: es el desciframiento o decodificación de la información contenida en
el ADN.
La expresión genética se da en dos etapas, representadas de la siguiente manera:
TRANSCRIPCIÓN: pasaje de la información contenida en el ADN al ARN.
TRADUCCIÓN: pasaje de una secuencia de nucleótidos, contenida en el ARN, a una
secuencia de aminoácidos (o se una proteína)
DUPLICACIÓN DEL ADN: cada molécula de ADN genera dos copias idénticas (este proceso
no tiene que ver directamente con la expresión genética sino que lo relacionamos como algo
necesariamente previo a la división celular ya que una célula duplicará su ADN para luego
repartirlo equitativamente entre las células hijas).
TRANSCRIPCION INVERSA: es el único paso “reversible” del dogma y solamente pueden hacerlo cierto tipo de virus
(retrovirus)
Es importante destacar el flujo de la información genética: del ADN hacia las proteínas (con la
excepción de la transcripción inversa).
TRANSCRIPCIÓN
Implica la síntesis de moléculas de ARN a partir de una molécula de ADN molde. Esta síntesis
la realiza la enzima ARN polimerasa, que “lee” los nucleótidos del ADN, busca ribonucleótidos
complementarios a éstos, y construye una cadena nueva en base a la información de una de
las hebras del ADN.
La ARN polimerasa se caracteriza porque:
- la hebra de ADN que toma como molde es la 3´ 5´, es decir que leerá esa cadena
molde en dirección 3´5´.
-
Sintetiza la cadena de ARN en dirección 5´3´, que será por lo tanto antiparalela y
complementaria a la hebra molde de ADN.
Ejemplo:
5´ATTCGACCGAATTT 3´
3´TAAGCTGGCTTAAA 5´
Hebra antimolde, positiva o codificante
Hebra molde, negativa o no codificante
transcripción
5´AUUCGACCGAAUUU 3´
Molécula de ARN
PROCESO DE LA TRANSCRIPCIÓN
Es muy similar en eucariontes y procariontes. Por eso describimos el proceso en líneas
generales y luego vemos las diferencias entre eucariontes y procariontes.
1- La ARN polimerasa reconoce una
secuencia específica de nucleótidos de
ADN: el promotor. El promotor será
reconocido específicamente por la ARN
polimerasa y de algún modo marcará el
punto de inicio de la transcripción de un
gen.
2- La ARN polimerasa comienza a
avanzar separando las dos cadenas del
ADN (rompiendo los puentes de
hidrógeno entre ellas) y
simultáneamente va leyendo la hebra
molde y sintetizando la cadena de ARN
complementaria. Los sustratos de la
transcripción serán los ribonucleótidos
trifosfatados (al incorporarse al ARN
rompen 2 enlaces fosfatos y liberan la
energía necesaria para unirse al ARN en
crecimiento)
3- La ARN polimerasa avanza hasta que
reconoce secuencias específicas del
ADN: las secuencias de terminación,
que señalan el fin de la transcripción
Comparación de la transcripción en eucariontes y procariontes:
PROCARIONTES
Un solo tipo de ARN pol (con varias
subunidades)
Promotor típico procarionte
Sin factores de transcripción
EUCARIONTES
3 tipos de ARN pol: ARN pol I, ARN pol II,
ARN pol III (cada una transcribe cierto tipo de
ARN)
Promotor típico eucarionte
Con factores de transcripción
En el citoplasma
Secuencias de terminación procariontes
ARNm no maduran ni se procesan
En el núcleo
Secuencias de terminación eucariontes
ARNm siempre se procesan
En ambos tipos celulares los ARNt y ARNr sufren un proceso de maduración, pero solamente
en eucariontes los ARNm son procesados. Otra diferencia entre ARNm euca y proca es que los
ARNm procariontes son policistrónicos (cada ARNm tiene información para más de una
proteína) mientras que los ARNm eucariontes son monocistrónicos ( cada ARNm tiene
información para solo una proteína)
El ARNm eucarionte recién transcripto se llama transcripto primario. Se caracteriza porque
contiene dos tipos de secuencias: los exones (secuencias codificantes, tienen información para
la síntesis proteica) y los intrones (secuencias no codificantes, es decir sin información y por
ello luego serán eliminadas).
Maduración de ARNm en eucariontes
Son 3 modificaciones que
ocurren en el núcleo:
1- capping: al extremo 5´se le
agrega un nucleótido modificado
o CAP (protege al extremo 5´ y
luego en la traducción permitirá
el reconocimiento del ribosoma)
2- Poliadenilación: agregado al
extremo 3´de una sucesión de
adeninas, la cola poli-A (protege
al extremo 3´)
3- Splicing: eliminación de
intrones y empalme de exones.
El resultado es un ARNm
maduro.
TRADUCCIÓN
Implica el desciframiento del ARNm a una secuencia de aminoácidos. ¿Por qué “traducción?
Porque entre ARN y proteína hay un evidente cambio de lenguaje: de los nucleótidos pasamos
a los aminoácidos. Debe haber entonces, como en toda traducción, un “diccionario” que
permita hacer equivalencias entre ambos lenguajes. Es decir, que establezca relaciones de
correspondencia entre los nucleótidos y los aminoácidos. Estamos hablando del Código
genético.
El código relaciona codones (secuencias de 3 nucleótidos consecutivos presentes en el ARNm)
con aminoácidos. El código genético tiene 3 características:
- es universal: el mismo código es aplicable a todos los seres vivos
-
-
es degenerado: existen codones sinónimo, es decir que varios codones distintos
codifican el mismo aminoácido (ej: CCA – CCC – CCU – CCG codifican todos para
prolina, luego son codones sinónimo)
no es ambiguo: a cada codón le corresponde un y solo un aminoácido.
De todos los codones que presenta el código:
- AUG que codifica para metionina. Es el codón que marcará el inicio de la traducción.
- UAG, UGA, UAA que son los codones de terminación, señalan el fin de la traducción
Repasemos algunas características de los tres tipos de ARN:
ARNm
 lleva, en su secuencia de nucleótidos, la información para una secuencia de
aminoácidos.
 a cada conjunto de tres nucleótidos consecutivos se los llama codón o triplete. Un
codón codifica para un aminoácido.
ARNr



ARNt




Hay distintos tipos de ARNr que se distinguen fundamentalmente por su tamaño
Se asocian con proteínas ribosomales y constituyen así los ribosomas.
Los ribosomas están formados por dos subunidades, la mayor y la menor. Son el lugar
físico de la síntesis proteica.
Transporta los aminoácidos hacia el ribosoma
Tiene bases modificadas químicamente
Está plegado en forma de trébol
Tiene un anticodón, que será complementario a algún codón del ARNm
¿En qué consiste la traducción? Dado un cierto ARNm, se comienza a leer desde el extremo
5´hacia el 3´buscando el primer codón AUG que aparezca: la traducción comienza allí. Se irán
leyendo progresivamente los codones y traduciendo a aminoácidos y hasta que aparezca un
codón de terminación. Veamos un ejemplo:
5´CCUAGAUGCCCUUUGCAGGCUAACCCU 3´
ARNm
traducción
Met- pro – fen –ala – gli – terminación.
Proteína
PROCESO DE SÍNTESIS DE PROTEÍNAS
a- Aminoacilación: implica cargar a cada ARNt con el aminoácido específico que deberá
transportar. Esto se lleva a cabo por enzimas específicas que son las aminoacil ARNt
sintetasas que hacen esto con consumo de ATP.
b- Traducción: se divide en tres etapas: iniciación, elongación y terminación.
Iniciación: a la subunidad menor del
ribosoma se une el ARNm y el primer ARNt o
ARNt iniciador, que reconocerá al codón
inicio (lleva metionina). Luego se acopla la
subunidad mayor del ribosoma. Quedan así
definidos dos lugares contiguos en el
ribosoma: sitio P y sitio A. En el P queda
orientado el ARNt iniciador
Elongación: al sitio A ingresa un ARNt. El
aminoácido del sitio P se libera del ARNt y se
une al aminoácido que está en sitio A. La
enzima que cataliza esta unión es la peptidil
transferasa. El ARNt del sitio P está
“descargado” y sale del ribosoma. Luego se
produce un corrimiento del ribosoma hacia el
extremo 3´ del ARNm: la traslocación. Como
consecuencia lo que estaba en A pasa a
estar en P. Con lo cual ahora el sitio P vuelve
a estar ocupado y el A libre (igual a como
empezó esta etapa). Al sitio A llegará otro
ARNt, se formará otra unión peptídico,
traslocación, etc. Se repite hasta que al sitio
A ingresa un codón de terminación.
Terminación: el codón de terminación es
reconocido por factores de terminación. La
cadena de aminoácidos unidos se libera del
ARNt que la transporta, el ARNm ya leído
completamente se disocia del ribosoma y
finalmente las dos subunidades ribosomales
se desacoplan.
Diferencias en la traducción procariontes y eucarionte: en procariontes la traducción es cotranscripcional. Esto significa que es simultánea con la transcripción debido a que ambos
procesos (transcripción y traducción) ocurren en el mismo lugar (el citoplasma) y a que los
ARNm no sufren maduración ni procesamientos.
En eucariontes la traducción es post-transcripcional, es decir que ocurre una vez que la
transcripción terminó porque en este caso transcripción y traducción ocurren en lugares
diferentes (núcleo y citoplasma respectivamente) y además porque los ARNm siempre sufren
modificaciones antes de traducirse.
REGULACIÓN DE LA EXPRESIÓN
GENÉTICA
En los organismos pluricelulares, todas las células de un mismo individuo son genéticamente
idénticas (tienen las mismas moléculas de ADN) ya que son el producto de sucesivas
mitosis a partir de la cigota. A lo largo del desarrollo las distintas células van pasando por un
proceso de diferenciación celular, algo así como la especialización de los distintos tipos
celulares. Pero estas células tan diferentes unas de otras, con funciones tan diversas, son
genéticamente iguales. ¿Cómo se produjo esa diferenciación celular si todas son
genéticamente iguales? La respuesta tiene que ver con la expresión diferencial de los
genes. Es decir que, si bien todas las células de un mismo individuo tienen los mismos genes,
en cada una de ellas no necesariamente se expresan (transcriben y traducen) exactamente los
mismos genes. Y esa expresión diferencial es lo que hace la diferencia entre un tipo celular y
otro. Veamos un ejemplo ficticio pero sencillo.
Supongamos que el genoma humano consistiera solamente en cuatro genes: gen 1, gen 2, gen
3 y gen 4. Una neurona tendría esos cuatro genes y una célula epitelial también. Son dos tipos
de células bien diferentes y con funciones distintas también. ¿Qué las hace diferentes si sus
genes son los mismos? Por ejemplo, en la neurona podrían expresarse el gen 1, gen 3 y gen 4.
En la célula epitelial el gen 1 y el gen 2. Vemos que en ambos casos partimos de la misma
información pero la expresión de los genes es diferencial en cada caso.
¿Cómo se logra la expresión diferencial de los genes? Por mecanismos de regulación de la
expresión genética.
REGULACIÓN DE LA EXPRESIÓN GENÉTICA EN PROCARIONTES
La regulación es muy simple y se da a nivel de la transcripción. En procariontes los genes que
participan de una misma vía metabólica se expresan en forma conjunta, bajo un único promotor
y una única secuencia reguladora para todo el conjunto. A este conjunto se lo llama operón.
OPERON
Proteína
represora
GEN REGULADOR: gen cuya expresión es una proteína represora o represor
PROMOTOR: secuencia de ADN que será reconocida por la ARN polimerasa
OPERADOR: secuencia de ADN a la que puede unirse el represor
GENES ESTRUCTURALES: genes que se expresan en conjunto y que participan de una
misma vía metabólica.
OPERON: conjunto formado por promotor + operador + genes estructurales.
Veamos un ejemplo de regulación de este tipo: el Operón lactosa.
Este operón tiene la misma estructura de todos los operones. Sus genes estructurales, en este
caso, cuando se expresan generan como producto enzimas que son necesarias para degradar
la lactosa.
Los procariontes pueden degradar lactosa para así obtener energía. Para ello necesitan de
enzimas que les permitan hacer esa degradación. Si hay lactosa presente, serán necesarias
las enzimas que permitan degradarla. Si no hay lactosa presente esas enzimas no hacen falta.
Por lo tanto la regulación de la expresión de los genes estructurales en este ejemplo dependerá
de si hay o no lactosa presente para degradar. ¿Qué ocurriría en ambas situaciones?
SIN LACTOSA PRESENTE
El gen regulador produce una proteína represora activa. Esto significa que puede unirse al
operador. Cuando esto ocurre, la ARN polimerasa ve impedido su acceso a los genes
estructurales que como consecuencia no se transcriben, o sea, no se expresan.
CON LACTOSA PRESENTE
El gen regulador produce una proteína represora activa, pero, como hay lactosa presente, la
lactosa se une al represor. El efecto de esto es que el represor se inactiva, es decir que ya no
puede unirse al operador. De este modo la ARN polimerasa puede acceder a los genes
estructurales que de este modo pueden expresarse. Se sintetizarán así las enzimas que
permitirán degradar la lactosa.
REGULACIÓN DE LA EXPRESIÓN GENÉTICA EN EUCARIONTES
La regulación de la expresión genética en los eucariontes se da a muchos más niveles que en
los procariontes. Tenemos:
1) Regulación a nivel de la transcripción
- por factores de transcripción: los basales permiten que la ARN pol reconozca eficazmente
al promotor. Los específicos se relacionan con secuencias reguladoras que tienen que ver con
regular la intensidad de la transcripción.
- heterocromatinización: las porciones de cromatina que estén más condensadas, en forma
de heterocromatina, no se transcribirán
- metilación del ADN: modificación química que puede hacerse a ciertas secuencias de ADN
que de este modo ya no se expresarán.
2) Regulación a nivel del procesamiento del ADN: por ejemplo el splicing alternativo que
consiste en otras formas de splicing posibles diferentes a la “tradicional”. Por ejemplo, un exón
puede ser eliminado como si fuera un intrón. Este mecanismo permitiría generar, a partir de un
mismo ARN transcripto primario, varios ARNm maduros distintos según el splicing que se lleve
a cabo.
3) Regulación del transporte del ARNm desde el núcleo hacia el citoplasma.
4) Regulación de la traducción del ARNm.
5) Regulación de la actividad y estabilidad proteica.
Descargar