EL ADN, LOS CROMOSOMAS
Y LA GENÉTICA
Cuaderno 3
2
LAS LEYES DE MENDEL; SIMULACIÓN.
Mendel estudió la herencia de caracteres utilizando para sus experiencias plantas de
guisante dulce (Pisum sativum) y los resultados que obtuvo se conocen actualmente
como Las Leyes de Mendel:
Primera ley o ley de la uniformidad: cuando se cruzan dos homocigóticos o razas
puras los descendientes son todos iguales entre sí e iguales a uno de los progenitores.
Carácter estudiado: color del guisante
A(color amarillo) > a(color verde)
P
AA x aa
F1
Aa (amarillos)
Segunda ley o ley de la segregación independiente: cuando se cruzan dos individuos
de la primera generación filial (F1) que son híbridos, en la segunda generación aparece
el carácter que había quedado oculto en la primera (el color verde). Esto es debido a que
los genes se separan durante la formación de los gametos y vuelven a unirse en la
fecundación; como esta unión ocurre al azar podrán aparecer distintas combinaciones.
F1
Aa x Aa
F2
AA Aa Aa aa
Las frecuencias genotípicas son :
Las frecuencias fenotípicas son:
¼ AA,
25%
½ Aa,
50%
¼ aa
25%
¾ amarillos (AA +Aa) , ¼ verdes (aa)
75%
25%
Tercera ley o ley de la combinación independiente: cuando en un híbrido se combian
varios genes, estos se transmiten de forma independiente. En este caso, Mendel además
de fijarse en el color de los guisantes miraba si eran lisos o rugosos : B(liso) > b(rugoso)
y estudia como se heredan los dos rasgos concluyendo que son independientes, es decir,
que un guisante sea amarillo no influirá en que sea liso o rugoso.
P
F1
AABB x aabb
AaBa
3
F1
F2
Frecuencias fenotípicas
AaBb x AaBb
A_B_
9/16
3/16
3/16
1/16
A_bb
aaB_
aabb
amarillo y liso
(A_B_)
amarillo y rugoso (A_bb)
verde y liso
(aaB_)
verde rugoso
(aabb)
NOTA: la raya indica que puede ser A/a o bien B/b
SIMULACIÓN DE LA SEGUNDA LEY
Materiales
Por cada grupo de 2 alumnos necesitamos:
50 cuadrados de cartulina amarillos y 50 verdes
dos recipientes (bandejas por ejemplo) que representan los individuos a cruzar
tres cajas de Petri numeradas: 1, 2 y3
Procedimiento
Introducimos en cada bandeja 25 cuadrados amarillos y 25 verdes. Cada una
representa así un individuo híbrido para el rasgo color.
Mezclamos bien las cartulinas y con los ojos cerrados extraemos una de cada
bandeja de forma que:
*Si salen dos amarillas las metemos en la placa 1
*Si sale amarilla y verde las metemos en la placa 2
*Si salen dos verdes las metemos en la placa 3
Cuando hayas sacado todas las cartulinas cuenta los pares que tienes en cada
placa y anota los resultados en la siguiente tabla:
Tus datos
Número de parejas
Frecuencia
Nº de parejas/total
parejas
1. parejas amarillas
2.parejas amarillo/verde
3.parejas verdes
Si comparas tus resultados con los de Mendel ¿se parecen?
%
4
Si consideras que el rasgo amarillo domina sobre el verde y miras solo los
fenotipos ¿se parecen a los datos de Mendel?
Si tenemos más datos, es decir, más descendientes, los resultados se
aproximarán más a los obtenidos por Mendel. Para comprobarlo vas a reunir los datos
de toda la clase en la siguiente tabla:
1 parejas amarillas
2. parejas amarilla/verde
3.parejas verdes
Grupo 1
Grupo 2
Grupo 3
Grupo 4
Grupo 5
Grupo 6
total
Con todos los datos calcula ahora las frecuencias de cada tipo y anótalas en la
siguiente tabla:
Todos los datos
Número de parejas
Frecuencia
Nº de parejas/total
parejas
%
1. parejas amarillas
2.parejas amarillo/verde
3.parejas verdes
¿se aproximan ahora más los resultados?
¿qué representan los cartones? ¿por qué has de cerrar los ojos para cogerlos?.
Si tuvieramos 75 parejas ¿cuántas esperaríamos amarillas, híbridas y verdes?
5
LA HERENCIA DE CARACTERES EN LA ESPECIE
HUMANA
En la especie humana existen muchos rasgos que se heredan y de ellos muchos
pueden obsevarse a simple vista. Si recogemos datos de un amplio grupo de personas
podemos hacer conjeturas sobre que rasgo es dominante o recesivo o si hay casos de
codominancia ( ninguno domina sino que suele darse una mezcla de los dos, por
ejemplo, si A(rojo) y a (blanco) el híbrido, Aa, sería rosa).
Vamos a fijarnos en una serie de rasgos que podrás observar en la clase:
Lóbulo de la oreja: algunas personas tienen el lóbulo de la oreja separado de la piel de
la cara mientras otras lo tiene unido
Lóbulo de la oreja
modalidad
Nº de alumnos
frecuencia
porcentaje
libre
unido
Presencia de pelos en la segunda falange de los dedos de la mano: en el dorso de la
primera falange, todas las personas tienen más o menos pelo. Sin embargo, en la
segunda falange hay personas que tiene pelo y otras que no (puedes necesitar lupa).
Pelos en la segunda falange de los dedos
modalidad
Con pelos
Nº de alumnos
frecuencia
porcentaje
Sin pelos
Lengua en rollo: en algunas personas los músculos de la lengua están de tal forma que
pueden sacarla y luego enrrollarla en un tubo.
Lengua en rollo
modalidad
Nº de alumnos
frecuencia
porcentaje
si
no
Con los datos que tienes ¿qué conclusiones sacas de cada uno de esos rasgos?
6
EL ÁRBOL GENEALÓGICO
Un árbol genealógico es una representación de una familia diferenciándose las
sucesivas generaciones y resulta útil para realizar estudios genéticos cuando se sospecha
que algún rasgo puede tener un componente hereditario; permite además ver si la
herencia depende del sexo (herencia ligada al sexo) como en el daltonismo o en la
hemofilia y hacer cálculos sobre la probabilidad de que los descendientes tengan o no el
rasgo.
Para realizarlo hay que seguir unas normas: los varones se representan mediante
un cuadrado y las mujeres mediante un círculo. Cada generación se númera de arriba
hacia abajo con números romanos y dentro de cada generación cada individuo se
numera de izquierda a derecha. El rasgo que queremos estudiar se marca con color
sobre el símbolo de varón o mujer.
matrimonio
matrimon
ioNIO
I
Personas con el rasgo
estudiado
1
2
hijos
II
1
2
3
4
5
III
1
2
Aborto o niño que
muere en edad
temprana y del que
no sabemos su
rasgo
Intenta construir el árbol de tu familia y después fijate en un carácter o rasgo y márcalo
sobre el gráfico.
7
EL ADN ES EL PORTADOR DE LA INFORMACIÓN
GENÉTICA: Griffith y Avery.
En 1928, el bacteriólogo Griffith, trabajando con la bacteria causante de la neumonia
(Diplococcus pneumoniae) vio que existían dos cepas distintas:
Cepas S que presentaban en los cultivos una superficie suave (smooth) y una cápsula
que englobaba dos bacterias y
Cepas R que presentaban un aspecto rugoso (rough) y cuyas células carecían de
cápsula.
Comprobó que cuando inoculaba bacterias de tipo S a ratones, se producía en ellos la
neumonía y morían mientras que si inoculaba la cepa R los ratones no sufrían
enfermedad alguna:
Cepa S +
virulenta
Cepa R +
No virulenta
Comprobó también que si trataba las bacterias de la cepa S con calor, matándolas, y
luego inoculaba con ellas a los ratones, estos no padecían la neumonía:
Cepas S muertas por calor +
Finalmente, cuando inoculaba una mezcla de bacterias S muertas por calor, junto con
bacterias R vivas, al contrario de lo esperado, los ratones contraían neumonía y morían.
Al analizar la sangre de estos ratones muertos, se encontraban bacterias de tipo S
¡vivas!:
Cepa S muerta + cepa R +
Se extrae sangre y aparecen bacterias
S vivas
8
Griffith llamó a este fenómeno transformación, pues las bacterias de tipo R se
convertían en bacterias de tipo S. ¿qué crees que pasó?
En 1944 Avery y sus colaboradores vieron que podían realizar los experimentos de
Griffith en tubos de ensayo, sin necesidad de inocular ratones. Así, si mezclaban
bacterias S muertas por calor con bacterias R, después de un tiempo podían obtener
células S vivas.
Bacterias R
Se mezclan
Bacterias S
muertas
Se aislan
bacterias S vivas
A continuación fraccionaron las bacterias S muertas y separaron distintos componentes.
Mezclaron cada uno de ellos con las bacterias R y luego observaban si aparecían
bacterias S:
Bacterias S muertas
Se fraccionan y se extraen proteínas, ADN....que se mexclan con bacterias R
Proteínas + bacterias R................................. bacterias R
ADN + bacterias R....................................... bacterias S ¡vivas!
Cápsula + bacterias R ....................... ............bacterias R
Membranas + bacterias R..............................bacterias R
¿qué conclusiones crees que sacaron respecto a la transformación?
9
EL ADN: ESTRUCTURA SECUNDARIA
En 1953, Watson y Crick, propusieron un modelo de estructura secundaria para el
ADN que revolucionó las Ciencias Biológicas pues tal estructura abría todo un camino
de posibilidades para estudiar y comprender los mecanismos de la división celular y la
transmisión de la información de unas generaciones a las siguientes, así como para los
estudios posteriores sobre la transcripción y la traducción.
Watson y Crick con su modelo de ADN
Los ácidos nucléicos son polímeros de nucleótidos monofosfato; a su vez, estos
nucleótidos llevan tres elementos:
Base nitrogenada
Pentosa
Fosfato
En el caso del ADN, las bases nitrogenadas pueden ser de cuatro tipos: adenina,
guanina, citosina y timina; la pentosa es una desoxirribosa.
El ADN está constituído por dos cadenas de ácido nucleico, complementarias y
antiparalelas:
Complementarias: la adenina se une con la timina por dos puentes de hidrógeno y la
citosina con la guanina por tres.
Antiparalelas pues una lleva la dirección 5´3´ y la otra va en dirección 3´5´
(3´significa que en ese extremo, la desoxirribosa tiene el –OH del carbono 3´libre y 5´se
refiere al carbono 5´de la desoxirribosa que llevará el fosfato).
El siguiente ejercicio pretende que construyas 4 nucleótidos partiendo de sus elementos
(fosfato, base nitrogenada y pentosa). Después, teniendo en cuenta la
complementariedad de bases y la dirección de las hebras, puedes unirlos formando así
una pequeña región de ADN de 4 nucleótidos apareados de dos en dos. Al final, si unes
tu fragmento con el del resto de la clase, construireis una molécula de ADN. Cuando la
hagais, recordad que las bases nitrogenadas se disponen perpendiculares al eje general
de la molécula.
10
Recorta las figuras y únelas por las pestañas para formas 4 nucleótidos. Luego
pégalos entre si teniendo en cuenta la complementariedad de bases y la dirección que
llevan. Te recomiendo que colorees las bases, por ejemplo: adenina y timina de rojo y
guanina y citosina de azul.
11
ESTUDIO DE LOS CROMOSOMAS
Como sabes, el cromosoma es una forma de cromatina (ADN + proteínas) altamente
condensada que aparece cuando la célula se va a dividir facilitando el reparto del
material genético entre las células hijas.
Los cromosomas presentan distintas partes, como puedes ver en la figura 1, y además
no son todos iguales, diferenciándose por la posición del centrómero, por la presencia
de las llamadas constricciones secundarias y por la presencia de satélites .
Según la posición del centrómero, los cromosomas se
clasifican en 4 grupos:
-metacéntricos, cuando los dos brazos son iguales, es decir,
el centrómero está en el medio
-submetacéntricos, con un brazo ligeramente mayor que
otro
-acrocéntricos, con un brazo claramente mayor que otro
-telocéntricos, con un solo brazo, pues el otro es tan
pequeño que prácticamente no existe
En la figura 4 tienes una serie de cromosomas. Recórtalos y pégalos en la casilla que
corresponda de la siguiente tabla:
cromosomas
Metacéntricos
Submetacéntricos
Acrocéntricos
Telocéntricos
Sin constricción 2ª
/sin satélite
con constricción 2ª Sin constricción 2ª
/sin satélite
/con satélite
con constricción 2ª
/con satélite
12

13
EL CARIOTIPO
Durante la metafase de la división celular, los cromosomas duplicados y unidos
por el centrómero, se colocan en el plano ecuatorial de la célula para luego separarse y
repartirse entre las dos células hijas.
Recuerda que en la meiosis, al ser una división reductiva, en la primera parte,
las dos células se reparten los cromosomas duplicados (estructura llamada tetrada), es
decir, cada célula recibe un cromosoma doble de cada tipo (una célula con 46
cromosomas tendría ahora 23); en la segunda división, semejante a una mitosis, los
cromosomas duplicados (cada uno con dos cromátidas unidas por el centrómero) se
“rompen” enviando una copia a cada célula (la célula que tenía 23 cromosomas cada
uno con dos cromátidas, se divide en dos células cada una con 23 cromosomas).
En ese momento en que los cromosomas están en metafase es “fácil” observarlos
todos y es la fase que se utiliza para teñirlos y fotografiarlos. Esa fotografía se llama
cariotipo y su estudio nos aporta datos sobre su dueño, por ejemplo su sexo, pero
también datos sobre alteraciones como aumento o disminución del número de
cromosomas (sindrome de Down, sindrome de Turner... ) o mutaciones que producen
cambios en el tamaño de los cromosomas: se pierde un fragmento, se gana un
fragmento...).
La figura que tienes a la izquierda es un
cariotipo de un individuo de la especie
humana de sexo masculino. Los
cromosomas se tiñen con una técnica
particular que les da un bandeado típico.
Fijate que cada cromosoma tiene una sola
cromatida y no dos como en los dibujos que
verás a continuación. ¿en que momento de
la división celular los vemos de esta
manera?____________________________
___________________________________
Los cromosomas están ordenados y agrupados siguiendo unos criterios que tendrás que
descubrir.
14
Como sabes, tenemos 46 cromosomas, que en realidad son 23 parejas, pues tenemos dos
de cada tipo en todas las células de nuestro cuerpo excepto en
¿cuáles?_______________________
Por otro lado, de esas 23 parejas, una pareja corresponde a los cromosomas
sexuales XX en la mujer y XY en el hombre. La figura que tienes a continuación te
muestra a esas parejas sexuales; como puedes observar la pareja XY es un poco dispar.
Gracias a esa disparidad
podemos distinguir en el cariotipo
un individuo de sexo masculino de
uno femenino, es sencillo...solo
tienes que buscar entre los 46 cromosomas a los dos sexuales XX o XY. ¿cuáles crees
que son los cromosomas sexuales del cariotipo anterior? Márcalos
1ª PARTE: ESTUDIO DE LA MORFOLOGÍA DE LOS CROMOSOMAS
HUMANOS: EL IDIOGRAMA.
Como ves en la fotografía, puede ser complicado reconocer los cromosomas pues
pueden estar doblados o borrosos. Para hacerlo más sencillo vas a utilizar dibujos de
cariotipos. La figura 6 es el primero que usaremos:
1º-fijándote en los cromosomas sexuales intenta averiguar el sexo del individuo al que
corresponde este cariotipo.
2º-recorta los cromosomas y reúnelos por parejas, ordenándolos de mayor a menor y
asignando a cada pareja un número, empezando por el 1.
15

16
A continuación tienes una tabla con la ordenación correcta de un individuo humano de
sexo masculino. Esta tabla se llama Idiograma; en ella los cromosomas están
agrupados en 7 grupos (desde el A al G).
Averigua que características comunes tienen los cromosomas pertenecientes a cada uno
de los grupos:
Grupo A
Grupo B
Grupo C
Grupo D
Grupo E
Grupo F
Grupo G
17
2º PARTE: CONSTRUCCIÓN DE UN IDIOGRAMA.
Realiza ahora el idiograma correspondiente a los cromosomas del individuo cuyo
cariotipo tienes en la figura 8. Para ello recorta los cromosomas y pégalos en la tabla
siguiente ( utiliza como referencia el idiograma de la página anterior).
18

19
3ª PARTE: RECONOCIMIENTO DE ALTERACIOINES A PARTIR DEL
CARIOTIPO: mutaciones genómicas y mutaciones cromosómicas.
A continuación tienes tres cariotipos humanos cada uno con una alteración que
produce determinado síndrome. Averigua en cada caso cúal es la alteración
cromosómica que produce la enfermedad y consulta algún texto para saber que
características tienen esas personas.
1º
2º
20
3º
Los tres cariotipos que acabas de ver corresponden a tres síndromes en los que se ha
producido mutación. Las mutaciones observadas corresponden a dos tipos: mutaciones
genómicas en las que se altera el nº de cromosomas del cariotipo de la especie y
mutaciones cromosómicas en las que se producen cambios en la disposición de los
genes en los cromosomas, unas veces con pérdida de información genética, otras con
ganancia y otras sin variación en la cantidad de información.
Indica a que tipo de mutación corresponden los síndromes anteriores:
Síndrome de Down
Síndrome de Klinefelter
Sindrome de “grito de gato”
21
En el siguiente cuadro tienes otras mutaciones en la especie humana; complétalo:
Mutación
Enfermedad
Síntomas clínicos
Sindrome de Down
Trisomía del par 13
Síndrome de Patau
Trisomía del par 18
Síndrome de Edwars
Trisomía del X
Síndrome triple X
Malformaciones:
labio
leporino,
hexodactilia,
ausencia de bulbo olfatorio.
Muerte precoz
Malformaciones cardíacas,
orejas de aspecto faunesco,
prominencia
occipital.
Muerte precoz
Transtornos
en
la
menstruación. Menopausia
precoz.
Síndrome de Klinefelter
XYY
No apreciables
Síndrome duplo Y
monosomía del X (falta un
cromosoma X)
Síndrome de Turner
Mujeres con caracteres
secundarios
infantiles,
esterilidad y retraso mental
Síndrome de “grito de
gato”
Pérdida (deleción) de un
trozo del brazo largo del retinoblastoma
cromosoma 13
Cáncer de retina
22
LA TRANSCRIPCIÓN Y LA TRADUCCIÓN
(en procariotas)
A continuación tienes una secuencia de ADN a partir de la que vas a realizar la
transcripción para obtener un ARNm.
CGCTATAATGATCGCTGTAATCGTGCATATAGCGCTGCAGACTTACTTAGCTTGTCGTCTTCACCCCATTCGCGCGCGAAAAAAAA-5´
GCGATATTACTAGCGACATTAGCACGTATATCGCGACGTCTGAATGAATCGAACAGCGAAGTGGGGTAAGCGCGCGCTTTTTTTT-3´
Como sabes la transcripción del ARN consiste en copiar un fragmento de una de
las dos hebras del ADN. La hebra de ADN que se va a copiar tiene secuencias llamadas
centros promotores que serán reconocidas por una subunidad del enzima ARNpolimerasa. La transcripción se iniciará a partir de un número determinado de
nucleótidos después del centro promotor.
Uno de estos centros promotores tiene la siguiente secuencia: TATAAT y diez
bases después de él se inicia la copia del ADN.
Así,
1º localiza esa secuencia en una de las hebras del ADN y márcala
2º a partir de ella cuenta diez bases y en la siguiente (nº 11) comenzará la síntesis del
ARNm
3º construye el ARNm (recuerda que en el ARN no tienes timina y si uracilo!)
Si ya tienes tu ARNm fijate en su extremo final...tienes una seria de CG que alternan y
luego un resto de U (secuencia poli-U). Esa serie CG pueden aparearse y formar una
horquilla. Eso constituye una señal de terminación de la transcripción y obliga a la
ARN-polimerasa a separarse del ADN. Intenta unir las bases para formar esa horquilla.
23
Ahora, a partir del ARNm vamos a proceder a la traducción, es decir, a
construir un péptido según las órdenes escritas en el ADN y que tenemos transcritas en
el ARNm.
En la traducción, cada tres bases (codón) del ARNm van a determinar un aminoácido
que será llevado por un ARN transferente, organizándose toda la maquinaria a través de
los ribosomas.
Para que los ribosomas se unan al ARNm y se inicie la traducción, es necesario
que un ARN ribosómico (ARNr 16 S) reconozca una zona del ARNm. Después, las dos
subunidades del ribosoma se ensamblan y se desplazan por el ARNm hasta encontrar el
codón de iniciación :AUG que corresponde al aminoácido metionina. Este será, por lo
tanto nuestro primer aminoácido en el péptido. En resumen:
1º busca la secuencia del ARNm complementaria del ARNr 16 S siguiente:
______________GCAUAUAGCG______________ (ARNr 16 S)
2º después de esa unión, localiza el codón de iniciación y
3º a partir de él, debes ir leyendo los codones y buscando su correspondecia con
aminoácidos según el código genético que tienes en esta actividad
escribe el péptido obtenido
24
MUTACIONES
Con la misma secuencia de ADN vamos a ver el efecto de distintas mutaciones, por
cambio de nucleótidos, por eliminación de éstos o por adiccción.
Para ello consideramos solo la hebra de ADN con información para la proteína: como
habrás comprobado la hebra codificante era la de la parte de arriba...el primer
aminoácido, metionina, tiene como codón en el ARNm AUG y esto corresponde con el
triplete TAC del ADN.
El fragmento que nos interesa del ADN es el siguiente:
3´-----TACTTAGCTTGTCGTCTTCACCCCATT--------5´
este fragmento nos dió el siguiente ARNm:
5´-----AUGAAUCGAACAGCAAAGUGGGGGUAA------3´
STOP
y a partit de este ARNm obtuvimos el siguiente péptido:
met-asn-arg-thr-ala-lys-trp-gly
Ahora que ya tienes la solución del ejercicio anterior, vamos a fijarnos en el triplete de
ADN marcado en negrita: GCT y vamos a mutarlo de distintas maneras (en cada una,
convierte el triplete de ADN en un codón de ARNm y averigua lo que ocurre con el
aminoácido resultante y explica qué pasará con la proteína).
1º. Cambiamos la 3ª base: GCT x GCA
2º. Cambiamos la 2ª base: CGT x GTT
3º. Cambiamos la 1ª base: GCT x ACT
4º. Añadimos una base: GCTT (ahora debes ver como afecta al resto de la cadena)
25
5º. Quitamos una base: GT
Este tipo de mutaciones que has observado se denominan mutaciones génicas. Los
efectos que pueden tener en la proteína son variados, y por eso distinguimos varios
tipos:
1. silenciosa: mutación por cambio de base pero que codifica para el mismo
aminoácido original debido a que el código genético es degenerado. No tiene
ningún efecto.
2. neutra: mutación en la que al cambiar la base, cambia el aminoácido, pero la
proteína no resulta alterada (el aminoácido ocupa una zona de la proteína que no
es importante para su función).
3. de cambio de sentido: mutación en la que el cambio de base produce un cambio
de aminoácido y la proteína se ve alterada (el aminoácido puede ser, por
ejemplo, parte del centro activo de un enzima).
4. sin sentido: mutación por cambio de base que origina en el ARNm un codón
STOP por lo que la proteína no se construye.
Cuando anadimos o suprimimos una base, el efecto es más drástico pues se ven
afectados todos los codones por detrás de la mutación , y por tanto, todos los
aminoácidos.
Indica a que tipo de mutaciones génicas corresponden los 5 casos anteriores.
26
EL ADN RECOMBINANTE:
construcción de un plásmido recombinante
La tecnología del ADN recombinante permite trasladar información genética de
unos organismos a otros. Esto es posible por la universalidad de los componentes
moleculares de los organismos y tiene numerosas aplicaciones en el campo de la
industria, la medicina y la agricultura. Un ADN recombinante es un fragmento de ADN
construído de forma artificial con ADNs de distintos organismos.
En general, las técnicas empleadas en la manipulación genética consisten en
localizar genes, fragmentar el ADN, empalmar unos trozos con otros, duplicar los
fragmentos e introducirlos en alguna célula con algún fin determinado: obtención de
sustancias para producir medicamentos, mejora del rendimiento de una planta, etc.
Para cortar el ADN en lugares concretos se utilizan las llamadas enzimas de
restricción; estos enzimas descubiertos en bacterias, son endonucleasas que cortan el
ADN en secuencias concretas. El corte deja en los extremos secuencias de hebra
sencilla que serán complementarias. Así, si cortamos con un mismo enzima de
restricción el ADN de una bacteria y el de una planta y luego los mezclamos, los dos
ADNs pueden unirse por los extremos dejados por el enzima.
Cuando cortamos el ADN nos puede interesar un fragmento que lleve un
determinado gen, en este caso el gen para una hormona (hormona del crecimiento). Si
queremos transferir este gen a otro organismo usaremos un vector, normalmente un
plásmido o un virus.
Así, para construir una molécula de ADN recombinante se somete el ADN del
vector y el ADN del organismo que nos interesa a la acción de un enzima de restricción.
Los extremos de los lugares de corte son cohesivos puesto que se unen fácilmente por
sus secuencias complementarias. Las uniones se refuerzan con la ayuda de enzimas
ligasas. El plásmido resultante (que tendrá nuestro gen incorporado, será un ADN
recombinante) se llama plásmido quimera. Como este plásmido puede duplicarse en la
bacteria el resultado es que nuestro gen también se copiará, es decir, conseguimos
clonarlo.
Un problema adicional es que al cortar el ADN para seleccionar el gen de la
hormona resulta difícil saber en que trozo de ADN tenemos nuestro gen. Por eso, la
construcción de la molécula de ADN recombinante no resulta tan “sencilla” como lo
descrito; en realidad utilizamos distintos plasmidos y distintas enzimas de restricción y
al final obtenemos una colección de plásmidos recombinados, cada uno con un trozo de
nuestro ADN. ¿cómo saber cual de ellos lleva el gen de la hormona?. Para ello se
utilizan plásmidos que llevan genes de resistencia a antibióticos de forma que nuestro
plásmido, el que lleva el gen de la hormona, va a ser además resistente a la acción de
determinados antibióticos. Al poner las bacterias a crecer en un medio de cultivo que
incluya dichos antibióticos solo sobrevivirán las bacterias que lleven dicho plásmido y
así, habremos capturado nuestro gen.
27
MATERIALES Y PROCEDIMIENTO
1º. ADN del plásmido: figura 1. Recorta los trozos de ADN del plásmido y únelos con
cinta adhesiva para formar una estructura circular que simule el plásmido. Fijate que ese
ADN lleva tres genes de resistencia a antibióticos y un origen de replicación necesario
para que el plásmido se duplique y se transfiera de célula a célula.
2º. ADN celular que contiene el gen para la hormona. Figura 2. une los distintos trozos
pero no lo cierres.
3º. Distintos enzimas de restricción (figura 3). Recórtalos y deslízalos sobre el ADN
del plásmido hasta que localices los lugares donde cortan dichos enzimas. Marca dichos
lugares en el ADN del plásmido. Realiza lo mismo para la secuencia de ADN celular
con el gen para la hormona y marca también los lugares de corte.
4º. Selecciona el enzima de restricción adecuada; recuerda
que este enzima:
-debe romper el plásmido pero dejando intacta la secuencia
de inicio de la replicación y al menos un gen para la
resistencia a un antibiótico.
-el mismo enzima debe romper el ADN con el gen para la hormona pero dejándonos
intacto dicho gen.
5º. Cuando tengas el enzima seleccionado corta el ADN celular y el plasmídico por los
lugares apropiados; a continuación pega los fragmentos y ya tienes tu plásmido
recombinado.
6º. Finalmente este plásmido lo tendremos que introducir en una bacteria en la que se
duplicará y así, clonaremos el gen. La figura 4 son bacterias para que rellenes con el
plásmido resultante; en la figura 5 tienes distintas placas de Petri con medios de cultivo
donde crecerán (o no) las bacterias. Indica en cual de ellas podrá crecer la bacteria que
ha incorporado tu plásmido.
28
Figura 1
29
Figura 2
30
figura 3: enzimas de restricción
31
figura 4
32
figura 5
33
Bibliografía
-Antonio Jimeno, M. Ballesteros, A. Pardo; L, Ugedo; Biología COU, Editorial
Santillana, 1992
-Carlos A, Miguel González, Araceli del Cañizo, Angel Costa Pérez; Biología 2º
Bachillerato; Editorial Everest 1999
-Juan Ängel España, José G. Conde Dominguez, Antonio Fernandez Diez...Actividades
Prácticas de Ciencias Naturales /1 Editorial Dossat, s.a. , 1980
-J: Cañeque, J. Martínez, C. Pulido, J. M. Roiz; Carpeta de actividades de laboratorio,
Biología E. Secundaria, volumen V y VI, Editorial TSD Enosa, 1998
-Rafaela López Módenes, Tomás Romero Martín, Carlos Salamanca Nuñez, Juan
Manuel Velasco Santos; Biología 2º bachillerto; Editorial Editex, 1988
-Juan E. Panadero, M. Rosario Fuente Floórez, Rosa Mª González Casado, Aurora
Lozano Montero, Antonio Olazabal Flórez, Blanca Razquín Peralta; Biología 2º
bachillerto; Editorial Bruño, 1998
-Miguel Sanz, Susana Serrano, Begoña Torralla; Biología 2º bachillerato; Editorial
Oxford Educación, 1999
Páginas de internet:
www.crosswind.net
www.cellsalive.com
www.cellbio.com
www.100cia.com
www.nyu.edu
www.eibe.info
www.cnice.mecd.es/enlaces
www.arrakis.es
34
INDICE
Las leyes de Mendel: simulación
La herencia de caracteres en la especie humana
El árbol genealógico
El ADN es el portador de la información genética
El ADN: estructura secundaria
Estudio de los cromosomas
El cariotipo
La transcripción y la traducción
Mutaciones
El ADN recombinante: construcción de un plásmido recombinante
Bibliografía
2
5
6
7
9
11
13
22
24
26
33
Descargar

EL ADN, LOS CROMOSOMAS - Educastur Hospedaje Web

EXAMEN DE BIOLOGIA 2.−DIBUJAR LA MEMBRANA PLASMATICA E INDICAR SUS PARTES

EXAMEN DE BIOLOGIA 2.−DIBUJAR LA MEMBRANA PLASMATICA E INDICAR SUS PARTES

ADN (Ácido Desoxirribonucleico)Algas rojasMembrana plasmáticaPlantas

La meiosis, un tipo especial de división celular

La meiosis, un tipo especial de división celular

GametosDivisión celular mitoticaBiologíaCromosomasCélulas

MITO DEL GEN Los comienzos: Gregor Mendel

MITO DEL GEN Los comienzos: Gregor Mendel

ADN (Ácido Desoxirribonucleico)Plasma germinalDoble héliceProteínasGenéticaCromosomasGenesGregor Mendel

Expresión de la información genética

Expresión de la información genética

AminoácidosProteínasGenéticaDescodificación del ADN (Ácido Desoxirribonucleico)Transferentes

Núcleo de la célula eucariótica

Núcleo de la célula eucariótica

ADN (Ácido Desoxirribonucleico)CitologíaMembrana nuclearBiologíaCromosomasARN (Ácido ribonucleico)