20
Aislamiento y manipulación de genes
TEXTO
Preguntas clave
-
¿Cómo se puede aislar y amplificar un gen mediante clonación?
-
¿Cómo se pueden identificar DNAs o RNAs específicos en mezclas?
-
¿Cómo se puede amplificar DNA sin clonarlo?
-
¿Cómo se utiliza el DNA amplificado en la genética?
-
¿Cómo se puede aplicar la tecnología del DNA a la medicina?
Esquema
20.1 Generación de moléculas de DNA recombinantes
20.2 Amplificación de DNA in vitro: la reacción en cadena de la polimerasa
20.3 Determinación de la secuencia de bases de un segmento de DNA
20.4 Análisis genético directo mediante clonación posicional
20.5 Detección de alelos causantes de enfermedades humanas: diagnóstico mediante
genética molecular
20.6 Ingeniería genética
Las plantas y animales domesticados proceden de la selección artificial realizada por el
hombre sobre caracteres deseables que se pueden encontrar en las poblaciones naturales.
La revolución agrícola, que tuvo lugar hace más de 10 000 años, fue impulsada por los
1
primeros agricultores que escogieron sembrar semillas de plantas que expresaban ciertos
caracteres que incrementarían su valor como fuente de alimento. Un ejemplo de uno de
estos caracteres en la domesticación de varias especies de plantas es la retención de las
semillas. Las semillas de las plantas salvajes normalmente se caen de las plantas (el
llamado desgrane), de manera que la descendencia es dispersada lejos del progenitor. En
cambio, las semillas de muchas plantas de cultivo no se desgranan y son, por tanto,
cosechadas más fácilmente. No es difícil imaginar una situación en que una antigua
tribu estaba recogiendo semillas para alimentarse y encontró un individuo o población
que retenía las semillas. No sólo se comerían estas semillas, sino que las guardarían y
plantarían.
El desgrane es uno de los muchos caracteres que han transformado las especies
salvajes en cultivos domesticados. A veces, esta transformación ha sido tan drástica que
es
(pág. 715)
(pág. 716)
difícil identificar el progenitor salvaje de un determinado cultivo. Uno de estos casos es
el maíz, que aunque es una gramínea, no se parece a ninguna especie de gramínea
existente. En 1939, George Beadle propuso que, a pesar de las evidentes diferencias
morfológicas, el progenitor más probable del maíz es una gramínea llamada teosinte,
que aún crece en estado salvaje en México (Figura 20-1). ¿Cómo fueron capaces los
primeros agricultores de provocar la transformación radical del teosinte en maíz? Como
veremos, utilizando las técnicas descritas en este capítulo, los genetistas han aislado uno
de los genes más importantes de esta transformación.
Los genes, como los que fueron seleccionados por los humanos en la
domesticación de plantas y animales, son el principal elemento de estudio de los
genetistas, y por tanto, es claramente necesario ser capaz de aislar un gen de interés (o
2
cualquier región del DNA) en un genoma y amplificarlo para obtener una cantidad
suficiente para su estudio. La tecnología del DNA es un término que se utiliza para
describir el conjunto de técnicas para obtener, amplificar y manipular fragmentos
específicos del DNA. Desde la mitad de los años setenta, el desarrollo de la tecnología
del DNA ha revolucionado el estudio de la biología, abriendo muchas áreas de estudio a
la investigación molecular. La ingeniería genética, la aplicación de la tecnología del
DNA a problemas biológicos, médicos o agrícolas específicos, es actualmente una rama
bien establecida de la tecnología. La genómica es la extensión de esta tecnología al
análisis global de los ácidos nucleicos presentes en un núcleo, una célula, un organismo
o un grupo de especies relacionadas (véase el Capítulo 13). En este capítulo, veremos
como las técnicas de la tecnología del DNA y la genómica, junto con los métodos
presentados en los Capítulos 2 y 4, pueden ser utilizados para aislar e identificar un gen.
20.1 Generación de moléculas de DNA recombinantes
¿Cómo se pueden aislar cantidades suficientes de determinados segmentos de DNA?
Esta tarea podría parecer de entrada como encontrar una aguja en un pajar. Se produjo
un avance decisivo cuando los investigadores consiguieron crear las grandes cantidades
de DNA que necesitaban engañando a la maquinaria de replicación de DNA para que
replicara el segmento en cuestión. Esta replicación se podía realizar dentro de células
bacterianas vivas (in vivo) o en un tubo de ensayo (in vitro). El método in vitro se
explicará en la Sección 20.2.
En el método in vivo, un investigador empieza con una muestra de moléculas de
DNA que contenga el gen de interés. Esta muestra se denomina DNA donante y con
frecuencia es un genoma entero. Fragmentos de este DNA donante son insertados
dentro de cromosomas “accesorios” no esenciales (tales como plásmidos o virus
3
bacterianos modificados). Estos cromosomas accesorios serán “portadores” del gen de
interés y lo amplificarán, y de ahí que sean llamados vectores. Primero, las largas
moléculas de DNA donante se cortan en cientos o miles de fragmentos de una medida
más manejable. A continuación, cada fragmento es fusionado con un cromosoma vector
cortado para formar moléculas de DNA recombinante. Las moléculas de DNA
recombinante se introducen dentro de células bacterianas y, generalmente, sólo una
molécula recombinante es aceptada en cada célula. Como el cromosoma accesorio se
amplifica normalmente por replicación, la molécula recombinante será amplificada de
manera similar durante el crecimiento y la división de la célula bacteriana en que se
encuentra. Este proceso resulta en un clon de células idénticas, en que cada una contiene
la molécula de DNA recombinante, y por tanto, esta técnica de amplificación se llama
clonación de DNA. El siguiente paso es encontrar el clon que contiene el DNA de
interés, que estará presente en muy baja frecuencia.
Para ilustrar como se genera el DNA recombinante, examinaremos la clonación
del gen de la insulina humana, una hormona proteica utilizada en el tratamiento de la
diabetes. La diabetes es una enfermedad en que los niveles de azúcar en la sangre son
anormalmente altos debido a que el cuerpo no produce suficiente insulina (diabetes tipo
I) o a que las células son incapaces de responder a la insulina (diabetes tipo II). En casos
leves de diabetes tipo I,
(pág. 716)
(pág. 717)
la enfermedad se puede tratar mediante restricciones dietéticas, pero para muchos
pacientes son necesarios tratamientos diarios con insulina. Hasta hace 20 años, las vacas
eran la principal fuente de insulina. La proteína se obtenía de los páncreas de animales
sacrificados en el matadero y era purificada a gran escala para eliminar la mayor parte
de proteínas y otros contaminantes presentes en los extractos de páncreas. Entonces, en
4
1982, salió al mercado la primera insulina humana recombinante. La insulina humana se
podía fabricar en una forma más pura, a un coste más bajo y a escala industrial porque
era producida en bacterias mediante técnicas de DNA recombinante. La insulina
recombinante se encuentra en una mayor proporción dentro de las proteínas de la célula
bacteriana que en el caso de la insulina bovina, de manera que la purificación de
proteínas es mucho más fácil. En este capítulo, seguiremos los pasos generales
necesarios para producir cualquier DNA recombinante y los aplicaremos al caso de la
insulina.
Tipos de DNA donante
La elección del DNA que se utilizará como donante podría parecer obvia, pero de hecho
hay tres posibilidades.
-
DNA genómico. Este DNA es obtenido directamente de los cromosomas del
organismo estudiado. Es la fuente de DNA más sencilla. El DNA cromosómico
necesita ser cortado para que la clonación sea posible.
-
cDNA. El DNA complementario (cDNA) es una versión en DNA de doble cadena
de una molécula de mRNA. En eucariotas superiores, el mRNA es más útil que una
secuencia genómica para predecir una secuencia de polipéptidos, porque los intrones
ya han sido eliminados. Los investigadores prefieren utilizar cDNA en lugar del
propio mRNA porque los RNAs son intrínsecamente menos estables que el DNA y
porque no existen técnicas rutinarias para amplificar y purificar una molécula de
RNA en particular. El cDNA se sintetiza a partir de mRNA utilizando una enzima
especial llamada transcriptasa inversa, aislada originalmente en los retrovirus.
Utilizando una molécula de mRNA como molde, la transcriptasa inversa sintetiza
5
una molécula de DNA de cadena simple que entonces puede ser usada como molde
para la síntesis de DNA de doble cadena. El cDNA no necesita ser cortado para
poder ser clonado.
-
DNA sintetizado químicamente. A veces, un investigador necesita incluir en una
molécula de DNA recombinante una secuencia específica que, por alguna razón, no
puede ser aislada a partir de los DNAs genómicos o cDNAs naturales disponibles.
Si la secuencia de DNA es conocida (con frecuencia porque existe una secuencia de
genoma completo), el gen puede ser sintetizado químicamente usando técnicas
automatizadas.
Para crear bacterias que expresen insulina humana, el cDNA fue la elección
inicial porque las bacterias no poseen la habilidad de eliminar los intrones presentes en
el DNA genómico. Además, debido a un fenómeno llamado sesgo en el uso de
codones, el cDNA humano tuvo que ser modificado químicamente para que pudiera ser
expresado óptimamente en bacterias. El sesgo en el uso de codones proviene de la
degeneración del código genético (el hecho que ciertos aminoácidos son codificados por
múltiples codones; véase la Figura 9-6). Por ejemplo, el código genético incluye seis
codones leucina y cuatro codones serina. El sesgo se refiere a la preferencia de un
organismo por uno o más codones para un aminoácido concreto. Para fabricar grandes
cantidades de insulina humana, el cDNA humano tuvo que ser modificado
químicamente para concordar con el sesgo en el uso de codones de E. coli.
Corte del DNA genómico
Las largas moléculas de DNA del tamaño de un cromosoma deben ser cortadas en
fragmentos de un tamaño mucho más pequeño. Este corte se realiza mediante el uso de
6
enzimas de restricción bacterianas. Estas enzimas cortan en secuencias de DNA
específicas llamadas dianas de restricción, y esta propiedad es una de las características
principales que hacen que las enzimas de restricción sean idóneas para la manipulación
del DNA. Por pura casualidad, cualquier molécula de DNA, sea derivada de virus,
moscas o humanos, contiene secuencias diana para las enzimas de restricción. Por lo
(pág. 717)
(pág. 718)
tanto, una enzima de restricción cortará el DNA en un conjunto de fragmentos de
restricción determinados por la localización de las diferentes dianas de restricción.
Otra propiedad clave de algunas enzimas de restricción es que crean extremos
cohesivos o “pegajosos”. Veamos un ejemplo. La enzima de restricción EcoRI (de E.
coli) reconoce la siguiente secuencia de seis pares de nucleótidos en el DNA de
cualquier organismo:
5’ -GAATTC- 3’
3’ -CTTAAG- 5’
Este tipo de segmento se denomina secuencia palindrómica, lo que significa
que ambas cadenas de DNA tienen la misma secuencia de nucleótidos pero en
orientación antiparalela. Diferentes enzimas de restricción cortan en diferentes
secuencias palindrómicas. A veces los cortes están en la misma posición en ambas
cadenas antiparalelas, pero las enzimas de restricción más útiles son las que hacen
cortes desfasados o escalonados. Por ejemplo, la enzima EcoRI hace cortes solamente
entre los nucleótidos G y A en cada cadena del palíndrome:
↓
5’ -GAATTC- 3’
7
3’ -CTTAAG- 5’
↑
Estos cortes escalonados dejan un par de extremos cohesivos idénticos de cadena
simple de cuatro bases de longitud. Los extremos se llaman cohesivos porque, al ser de
cadena simple, pueden aparearse (o sea, pegarse) con una secuencia complementaria.
Este tipo de apareamiento de cadenas simples a veces se denomina hibridación. La
Figura 20-2 (arriba, a la izquierda) representa la enzima de restricción EcoRI realizando
un único corte en una molécula de DNA circular como un
(pág. 718)
(pág. 719)
plásmido; el corte abre el círculo, y la molécula lineal resultante tiene dos extremos
cohesivos. Ahora puede hibridar con un fragmento de una molécula de DNA diferente
con los mismos extremos cohesivos complementarios.
Actualmente se conocen decenas de enzimas de restricción con diferentes
especificidades de secuencia. Algunas enzimas, como EcoRI o PstI, hacen cortes
escalonados, mientras que otras, como SmaI, hacen cortes nivelados y dejan extremos
romos. Incluso los cortes nivelados, que carecen de extremos cohesivos, pueden ser
utilizados para generar DNA recombinante.
Mensaje. Las enzimas de restricción cortan el DNA en fragmentos de un tamaño
manejable, y muchos de ellos generan extremos cohesivos de cadena simple que son
muy apropiados para producir DNA recombinante.
Unión del DNA donante con el vector
Normalmente se digieren tanto el DNA donante como el vector con una enzima de
restricción que produzca extremos cohesivos complementarios, y entonces se mezclan
8
en un tubo de ensayo para permitir que los extremos cohesivos del vector y del DNA
donante se unan entre sí y formen moléculas recombinantes. La Figura 20-3a muestra
un DNA de plásmido bacteriano que tiene una única diana de restricción para EcoRI;
por tanto, la digestión con esta enzima de restricción convertirá el DNA circular en una
molécula lineal con extremos cohesivos. El DNA donante proveniente de cualquier otra
fuente, como DNA humano, es también tratado con la enzima EcoRI para producir un
conjunto de fragmentos con los mismos extremos cohesivos. Cuando las dos muestras
se mezclan bajo las condiciones fisiológicas apropiadas, los fragmentos de DNA de
ambos tipos pueden hibridar gracias a la formación de dobles hélices entre sus extremos
cohesivos (Figura 20-3b). En la solución existen muchas
(pág. 719)
(pág. 720)
moléculas de plásmido abiertas, así como muchos fragmentos diferentes de DNA
donante cortados con EcoRI. Por tanto, el resultado será un conjunto variado de
plásmidos recombinados con diferentes fragmentos donantes. En este momento, las
moléculas híbridas no tienen todavía un esqueleto azúcar-fosfato unido covalentemente.
Sin embargo, esta estructura puede ser sellada mediante la adición de la enzima DNA
ligasa, que crea enlaces fosfodiéster en los puntos de unión (Figura 20-3c).
El cDNA puede unirse a un vector sólo utilizando la ligasa. También pueden
añadirse unos extremos cohesivos cortos a cada extremo del cDNA y del vector.
Otra consideración a tener en cuenta en este paso es que, si el gen clonado se
debe transcribir y traducir en el hospedador bacteriano, éste debe ser insertado cerca de
secuencias reguladoras bacterianas. Así pues, para ser capaz de producir insulina
humana en células bacterianas, el gen debe encontrarse adyacente a las secuencias
reguladoras bacterianas correctas.
9
Amplificación dentro de una célula bacteriana
La amplificación aprovecha diversos procesos genéticos procarióticos, incluyendo los
de transformación bacteriana, replicación de plásmidos y crecimiento de bacteriófagos,
todos ellos comentados en el Capítulo 5. La Figura 20-4 ilustra la clonación de un
segmento de DNA donante. Un único vector recombinante entra en una célula
bacteriana y es amplificado mediante la replicación
(pág. 720)
(pág. 721)
que tiene lugar durante la división celular. Generalmente hay muchas copias del vector
en cada célula bacteriana. Por tanto, después de la amplificación, una colonia de
bacterias normalmente contendrá billones de copias del único inserto de DNA donante
que se encuentra fusionado a su cromosoma accesorio. Este conjunto de copias
amplificadas del fragmento de DNA donante inicial dentro del vector de clonación es el
clon de DNA recombinante. La replicación de moléculas recombinantes explota los
mecanismos que la célula bacteriana usa normalmente para replicar el DNA
cromosómico. Un requisito básico es la presencia de un origen de replicación del DNA
(descritos en el Capítulo 7).
Elección de vectores de clonación. Los vectores deben ser moléculas pequeñas para
permitir una manipulación cómoda. También deben ser capaces de replicarse
prolíficamente en una célula viva para poder amplificar el fragmento donante insertado,
y deben tener las dianas de restricción adecuadas en las cuales se pueda insertar el DNA
que se quiere clonar. Idealmente, la diana de restricción debería estar presente sólo una
vez en el vector porque entonces los fragmentos de restricción del DNA donante se
insertarán en una única posición dentro del vector. También es importante tener una
manera de identificar y recuperar la molécula recombinante con rapidez. Actualmente se
10
utilizan un gran número de vectores de clonación según los diferentes tamaños de
inserto o los diferentes usos del clon. A continuación se explican las características de
diversas clases generales de vectores de clonación.
Plásmidos. Como se ha descrito anteriormente, los plásmidos bacterianos son pequeñas
moléculas circulares de DNA que replican su DNA independientemente del cromosoma
bacteriano. Los plásmidos usados rutinariamente como vectores son los que llevan
genes que confieren resistencia a fármacos. Estos genes proporcionan un método
práctico para seleccionar las células transformadas por los plásmidos: aquellas células
que aún estén vivas después de la exposición al fármaco deben poseer el vector
plasmídico que contiene el inserto de DNA. La Figura 20-5 ilustra como las
características de un vector, llamado pUC18, permiten la detección de plásmidos que
contienen DNA insertado.
Bacteriófagos. Diferentes clases de bacteriófagos pueden contener insertos de DNA
donante de diferentes tamaños. Un bacteriófago concreto puede albergar una cantidad
estándar de DNA como inserto “empaquetado” dentro de la partícula de fago. El
bacteriófago λ (lambda) es un vector de clonación efectivo para insertos de DNA de
doble cadena de hasta 15 kb. Las cápsides de fago λ pueden empaquetar moléculas de
DNA de hasta 50 kb de longitud (el tamaño de un cromosoma λ normal). La parte
central del genoma del fago no es necesaria para la replicación y el empaquetamiento de
moléculas de DNA de λ en E. coli y por tanto puede ser cortada mediante enzimas de
restricción y desechada. La parte central delecionada puede ser entonces sustituida por
insertos de DNA donante. El inserto tendrá de 10 a 15 kb de longitud, pues un inserto de
esta medida hace que la longitud total del cromosoma sea de nuevo las 50 kb normales.
11
Tal como muestra la Figura 20-6, las moléculas recombinantes pueden ser
directamente empaquetadas dentro de cápsides del fago in vitro y luego introducidas en
la bacteria. Alternativamente, las moléculas recombinantes pueden ser transformadas
directamente en E. coli. En cualquier caso, la presencia de calvas de fago en el
confluente bacteriano indica automáticamente la presencia de fagos recombinantes que
llevan un inserto.
Vectores para insertos de DNA de mayor tamaño. Los vectores estándar como los
plásmidos o el fago λ descritos anteriormente pueden aceptar DNA donante de tamaños
hasta 25 ó 30 kb. Sin embargo, muchos experimentos requieren insertos de tamaños
muy por encima de este límite superior. Para satisfacer esta necesidad, se han creado los
siguientes vectores especiales. En cada caso, después de que los DNAs se hayan
introducido en la bacteria, los vectores se replican como plásmidos grandes.
Los cósmidos son vectores que pueden contener insertos de 35 a 45 kb. Son
híbridos creados a partir de DNA de fago λ y de plásmido bacteriano. Los cósmidos se
insertan dentro de partículas de fago λ, que actúan como “jeringas” para introducir estos
grandes trozos de DNA recombinante dentro de células receptoras de E. coli. El
componente plasmídico del cósmido proporciona las secuencias necesarias para su
replicación. Cuando ya se encuentran
(pág. 721)
(pág. 722)
dentro de la célula, estos híbridos forman moléculas circulares que se replican
extracromosómicamente del mismo modo que los plásmidos. Los vectores PAC o
cromosomas artificiales de P1 (del inglés, P1 artificial chromosome) introducen el
DNA mediante un sistema similar pero pueden aceptar insertos de entre 80 y 100 kb. En
este caso, el vector es un derivado del bacteriófago P1, un tipo de fago que naturalmente
12
tiene un genoma más grande que el de λ. Los BAC o cromosomas bacterianos
artificiales (del inglés, bacterial artificial chromosome), derivados del plásmido F,
pueden contener insertos de 150 a 300 kb (Figura 20-7). El DNA que se quiere clonar se
inserta dentro del plásmido, y este gran DNA recombinante circular se introduce dentro
de la bacteria mediante un tipo especial de transformación. Los BACs son los vectores
utilizados para la clonación a gran escala requerida en los proyectos de secuenciación de
genomas (comentados en el Capítulo 13).
Finalmente, los insertos mayores de 300 kb necesitan un vector eucariótico
llamado YAC o cromosoma artificial de levadura (del inglés, yeast artificial
chromosome). Para construir un YAC, se añaden a un plásmido un centrómero y
orígenes de replicación de un cromosoma de levadura. El plásmido es linealizado,
pasándolo de una forma circular a una lineal y se le añade DNA de telómeros de
levadura. Esta construcción se comporta como un pequeño cromosoma de levadura
durante la mitosis y la meiosis.
Para clonar el gen de la insulina humana, se seleccionó un plásmido adecuado
para que portase los insertos relativamente cortos de cDNA de aproximadamente 450
pb. Este vector era un tipo especial de plásmido llamado vector de expresión. Los
vectores de expresión contienen promotores
(pág. 722)
(pág. 723)
bacterianos que inician la transcripción a altos niveles cuando se añade al medio de
cultivo el regulador alostérico apropiado. Por tanto, el vector de expresión inducirá la
producción de grandes cantidades de insulina humana recombinante en cada bacteria
que contenga el plásmido.
Entrada de las moléculas recombinantes en la célula bacteriana
13
Las moléculas de DNA foráneo pueden entrar en una célula bacteriana básicamente
mediante dos rutas: transformación y transducción (Figura 20-8). En la transformación,
las bacterias se bañan en una solución que contiene la molécula de DNA recombinante,
la cual entra en la célula y pasa a comportarse como un plásmido (Figura 20-8a). En la
transducción, la molécula recombinante se combina con proteínas de la cápside y la cola
de un fago. Entonces, estos fagos manipulados se mezclan con las bacterias e inyectan
su carga de DNA dentro de las células bacterianas. El resultado de la inyección puede
ser la introducción de un nuevo plásmido recombinante (Figura 20-8b) o la producción
de una progenie de fagos portadores de la molécula de DNA recombinante (Figura 208c), dependiendo del vector utilizado. En este último caso, las partículas libres de fago
resultantes infectan a las bacterias cercanas. Cuando se usa el fago λ, a través de ciclos
repetidos de infección, se forma una calva llena de partículas de fago a partir de cada
bacteria infectada inicial. Cada partícula de fago en una calva contendrá una copia del
cromosoma λ recombinante original.
Recuperación de las moléculas recombinantes amplificadas
El DNA recombinante empaquetado dentro de partículas de fago se puede obtener
fácilmente recogiendo el lisado celular resultante y aislando el DNA que contiene. Para
los plásmidos, las bacterias se rompen química o mecánicamente. El DNA del plásmido
recombinante se puede separar del cromosoma bacteriano principal, que es mucho
mayor, por centrifugación, electroforesis u otras técnicas selectivas.
Mensaje. La clonación de genes se realiza a través de la introducción de vectores
recombinantes únicos dentro de células bacterianas receptoras, seguida de la
14
amplificación de estas moléculas como resultado de la tendencia natural de estos
vectores a replicarse.
(pág. 723)
(pág. 724)
Construcción de genotecas genómicas y de cDNA
Hasta este momento se ha visto cómo construir y amplificar moléculas concretas de
DNA recombinante. Sin embargo, cualquiera de estos clones representa sólo una
pequeña parte del genoma de un organismo o una de las miles de moléculas de mRNA
que un organismo puede sintetizar. Para asegurarse de que se ha clonado el segmento de
DNA de interés, se tienen que crear grandes colecciones de segmentos de DNA que lo
incluyan todo. Por ejemplo, se toma todo el DNA de un genoma, se corta en segmentos
del tamaño correcto para el vector de clonación que se usará, y se inserta cada segmento
en una copia diferente del vector, de manera que se crea una colección de moléculas de
DNA recombinantes que, tomadas en conjunto, representan el genoma completo.
Entonces estas moléculas son transformadas o transducidas en células bacterianas
receptoras donde serán amplificadas en células separadas. La colección resultante de
bacterias o bacteriófagos portadores del DNA recombinante se denomina genoteca
genómica. Si se utiliza un vector que acepta insertos de un tamaño medio de 10 kb y la
medida del genoma completo es de 100 000 kb (aproximadamente el tamaño del
genoma del nematodo Caenorhabditis elegans), entonces 10 000 clones recombinantes
independientes contendrán el DNA equivalente a un genoma. Para asegurarse de que
todas las secuencias del genoma que puedan ser clonadas están representadas dentro de
la colección, las genotecas genómicas normalmente contienen un segmento determinado
del genoma repetido al menos cinco veces (y por tanto, en nuestro ejemplo, habrá 50
000 clones independientes en la genoteca genómica). Esta representación múltiple hace
15
que sea altamente improbable que, por casualidad, una secuencia no se encuentre al
menos una vez en la genoteca.
Del mismo modo, las colecciones representativas de insertos de cDNA requieren
decenas o cientos de miles de clones de cDNA independientes. Estas colecciones son
genotecas de cDNA y representan solamente las regiones codificadoras de proteínas del
genoma. Una genoteca de cDNA exhaustiva estaría basada en muestras de mRNA de
diferentes tejidos, diferentes fases del desarrollo y organismos que hayan crecido en
diferentes condiciones ambientales.
La elección sobre si construir una genoteca de DNA genómico o de cDNA
depende de cada situación. Si se busca un gen específico que es activo en un
determinado tipo de tejido en una planta o animal, entonces lo más lógico es construir
una genoteca de cDNA de una muestra de ese tejido. Por ejemplo, suponga que
queremos identificar cDNAs correspondientes al mRNA de la insulina. Las células de
los islotes B del páncreas son la fuente más abundante de insulina, y por tanto, los
mRNAs de células del páncreas serán el material apropiado para hacer una genoteca de
cDNA, ya que estos mRNAs deberían contener el gen en cuestión en mayor proporción.
Una genoteca de cDNA representa un subconjunto de las regiones transcritas del
genoma y, por tanto, será inevitablemente más pequeña que una genoteca genómica
completa. Aunque las genotecas genómicas son mayores, éstas tienen la ventaja de
contener los genes en su estado nativo, incluyendo intrones y secuencias reguladoras
que no se transcriben. Una genoteca genómica casi siempre es necesaria en las etapas
previas a la clonación de un gen completo o de un genoma en su totalidad.
16
Mensaje. La tarea de aislar un clon de un gen específico empieza con la construcción de
una genoteca de DNA genómico o de cDNA, si es posible, enriquecida en secuencias
que contengan el gen en cuestión.
Búsqueda de un clon específico
La construcción de una genoteca como se acaba de describir a veces se denomina
clonación “al azar” porque el investigador clona una muestra grande de fragmentos con
la esperanza de que uno de los clones contenga el gen deseado. El problema entonces es
encontrar ese clon en particular.
Búsqueda de clones específicos mediante el uso de sondas. Una genoteca puede
contener cientos o miles de fragmentos clonados. Esta gran colección de fragmentos
debe ser rastreada para encontrar la molécula de DNA recombinante que contiene el gen
de interés
(pág. 724)
(pág. 725)
para el investigador. Este rastreo se puede efectuar utilizando una sonda específica que
marcará únicamente el clon deseado. Existen dos tipos de sondas: (1) las que reconocen
una secuencia de ácidos nucleicos específica y (2) las que reconocen una proteína
específica.
Sondas para encontrar una secuencia de DNA. El uso de sondas para el DNA se basa
en la complementariedad de bases. Dos ácidos nucleicos de cadena simple con
secuencias de bases complementarias total o parcialmente se “encontrarán” una a otra
en una solución por colisión al azar. Después de unirse, forman un híbrido estable de
doble cadena. Esta propiedad del DNA ha proporcionado un procedimiento muy valioso
17
para encontrar secuencias de interés específicas. El uso de sondas para el DNA requiere
que todas las moléculas se conviertan en moléculas de cadena simple mediante calor.
Una sonda de cadena simple, marcada radioactiva o químicamente, encontrará su
secuencia diana complementaria en una población de DNAs como, por ejemplo, una
genoteca. Sondas pequeñas de tan sólo 15 o 20 pares de bases hibridarán con secuencias
complementarias específicas dentro de DNAs clonados mucho mayores. Así pues, se
pueden considerar las sondas como un “cebo” para identificar “presas” de mayor
tamaño.
La identificación de un clon específico en una genoteca es un procedimiento que
se realiza en dos pasos (Figura 20-9). Primero, se transfieren las colonias o calvas de la
genoteca sembradas en una placa de Petri a una membrana absorbente simplemente
extendiendo la membrana sobre la superficie del medio. A continuación se separa la
membrana, las colonias o calvas adheridas a la superficie se lisan in situ, y se
desnaturaliza el DNA. En segundo lugar, la membrana se sumerge en una solución con
una sonda de cadena simple específica para el DNA buscado. Generalmente, la sonda es
a su vez un trozo de DNA clonado que tiene una secuencia homóloga a la del gen
deseado. Esta sonda debe estar marcada con un isótopo radioactivo o un fluorocromo.
Así, la posición de un clon positivo será detectada por la concentración de señal
radioactiva o fluorescente. Para los marcajes radioactivos, la membrana se coloca
encima de un fragmento de película para rayos X y la desintegración del radioisótopo
produce partículas subatómicas que “exponen” la película, produciendo una mancha
negra en la porción de película situada justo encima del punto en que se encuentra
concentrado el radioisótopo. Esta película expuesta se llama autorradiografía. Si se
utiliza un fluorocromo como marcaje, se expone la membrana a luz de la longitud de
18
onda correcta para activar la fluorescencia del fluorocromo y se toma una fotografía de
la membrana para registrar su localización.
¿De donde proviene el DNA para hacer una sonda? El DNA puede proceder de
varias fuentes.
-
DNA complementario de un tejido que expresa el gen de interés a un alto nivel. Para
el gen de la insulina, el páncreas sería la elección obvia.
-
Un gen homólogo de un organismo relacionado. Este método depende de la
conservación evolutiva de las secuencias de DNA a lo largo del tiempo. Aunque el
DNA de la sonda y el DNA del clon deseado
(pág. 725)
(pág. 726)
podrían no ser idénticos, con frecuencia son suficientemente similares como para
inducir la hibridación. El método se suele llamar humorísticamente “clon por
teléfono” (en inglés, clone by phone), porque si un investigador puede llamar a un
colega que tenga un clon del gen de interés en un organismo relacionado, entonces
el trabajo de clonarlo en una nueva especie se vuelve relativamente fácil.
-
El producto proteico del gen de interés. La secuencia de aminoácidos de parte de la
proteína es traducida a la inversa utilizando la tabla del código genético en sentido
contrario (de aminoácido a codón), para obtener la secuencia de DNA que codifica
la proteína. Entonces se puede diseñar una sonda de DNA sintético que encaje con
esa secuencia. Recuerde, sin embargo, que el código genético es degenerado, es
decir, la mayoría de los aminoácidos son
(pág. 726)
(pág. 727)
19
codificados por múltiples codones. Por tanto, hay varias secuencias de DNA
posibles que podrían en teoría codificar la proteína en cuestión, pero sólo una de
estas secuencias es realmente la del gen que codifica la proteína. Para resolver este
problema, se selecciona un tramo corto de aminoácidos con la mínima degeneración
posible. Entonces, se diseña un conjunto de sondas mezcladas que contengan todas
las secuencias de DNA posibles que pueden codificar esa secuencia de aminoácidos
y se utiliza como sonda este “cóctel” de oligonucleótidos. La cadena correcta dentro
de este cóctel encontrará al gen de interés. Alrededor de 20 nucleótidos ya
proporcionan suficiente especificidad para hibridar con una única secuencia de DNA
complementaria en la genoteca.
-
RNA marcado. Es posible utilizar este tipo de sonda cuando se puede aislar de forma
casi pura un conjunto de moléculas idénticas de RNA, como por ejemplo el rRNA.
Sondas para encontrar proteínas. Si el producto proteico de un gen es conocido y ha
sido aislado en forma pura, entonces esta proteína puede ser utilizada para detectar el
clon del gen correspondiente en una genoteca. El proceso, descrito en la Figura 20-10,
requiere dos componentes esenciales. Primero, una genoteca de expresión, construida
utilizando vectores de expresión. Para construir esta genoteca, se inserta cDNA dentro
del vector en el marco de lectura correcto dentro de una proteína bacteriana (en este
caso, β-galactosidasa), para que las células que contienen el vector y su inserto
produzcan una proteína “de fusión” formada en parte por una traducción del inserto de
cDNA y en parte por un fragmento de la β-galactosidasa normal. En segundo lugar, el
proceso requiere un anticuerpo para el producto proteico específico del gen de interés.
(Un anticuerpo es una proteína sintetizada por el sistema inmune de un animal que se
une con gran afinidad a una determinada molécula). Este anticuerpo se utiliza para
20
rastrear la genoteca de expresión en busca de esa proteína. Se extiende una membrana
sobre la superficie del medio y se vuelve a separar de manera que sólo algunas de las
células de cada colonia queden adheridas a la membrana en las localizaciones
correspondientes a sus posiciones en la placa de Petri original (véase la Figura 20-10).
Entonces la membrana así “impresa” se seca y se sumerge en una solución con el
anticuerpo, que se unirá al rastro de cualquier colonia que contenga la proteína de fusión
buscada. Los clones positivos se pueden revelar mediante un anticuerpo secundario
marcado que se une al primer anticuerpo. Al detectar la proteína correcta, el anticuerpo
identifica el clon que contiene el gen que debe haber sintetizado esa proteína y que, por
tanto, contiene el cDNA deseado.
Mensaje. Un gen clonado puede ser seleccionado en una genoteca utilizando sondas
para la secuencia de DNA del gen o para el producto proteico de ese gen.
Sondas para encontrar un ácido nucleico específico en una mezcla. Como se verá
más tarde en el capítulo, en el curso de la manipulación de genes y genomas, a menudo
es necesario detectar y aislar una molécula de DNA o RNA específica que se encuentra
formando parte de una mezcla compleja.
El método más extensamente utilizado para detectar una molécula concreta
dentro de una mezcla es la transferencia, que empieza con una electroforesis en gel
para separar las moléculas de la mezcla. Primero nos fijaremos en el DNA. Una mezcla
de moléculas de DNA lineales se deposita dentro de un pocillo en un gel de agarosa, y
el extremo del gel donde se encuentra este pocillo se conecta al cátodo de un campo
eléctrico. Como las moléculas de DNA tienen cargas, los fragmentos migrarán a través
del gel hacia el ánodo a velocidades inversamente proporcionales a su tamaño (Figura
21
20-11). De este modo, los fragmentos de distintos tamaños formarán bandas definidas
en el gel. Estas bandas pueden visualizarse tiñendo el DNA con bromuro de etidio, que
hace que el DNA emita fluorescencia bajo la luz ultravioleta. El tamaño absoluto de
cada fragmento de la mezcla puede ser determinado mediante la comparación de su
(pág. 727)
(pág. 728)
distancia de migración con un conjunto de fragmentos estándar de tamaño conocido. Si
las bandas están bien separadas, una banda determinada se puede cortar del gel y la
muestra de DNA puede ser purificada. La electroforesis de DNA puede utilizarse tanto
con fines diagnósticos (mostrando los tamaños y las cantidades relativas de los
fragmentos de DNA presentes) como preparativos (útil para aislar fragmentos
específicos de DNA).
La digestión de DNA genómico con enzimas de restricción normalmente genera
tantos fragmentos que cuando se someten a electroforesis en gel obtenemos como
resultado una mancha amplia y difusa de DNA en lugar de bandas discretas. Utilizando
una sonda podemos identificar un fragmento específico de la mezcla mediante la técnica
desarrollada por E. M. Southern y conocida como transferencia de Southern (Figura
20-12). Al igual que la
(pág. 728)
(pág. 729)
identificación de clones (Figura 20-9), está técnica conlleva obtener una impresión de
las moléculas de DNA en una membrana realizando una transferencia del gel a la
membrana después de completar la electroforesis. El DNA debe ser desnaturalizado
previamente, lo que permite que se pegue a la membrana. A continuación, la membrana
es hibridada con la sonda marcada. Una autorradiografía o una fotografía de las bandas
fluorescentes revelarán la presencia de cualquier banda en el gel que sea
22
complementaria a la sonda. Si procede, las bandas pueden cortarse del gel y ser
procesadas.
La técnica de transferencia de Southern puede hacerse extensiva a la detección
de una molécula de RNA específica a partir de una mezcla de RNAs fraccionados en un
gel. En este caso se denomina transferencia de Northern (gracias al sentido del humor
de algún científico), para distinguirla de la técnica desarrollada por Southern para el
análisis de DNA. El RNA separado por electroforesis se transfiere a una membrana y se
hibrida con una sonda de la misma manera descrita para la técnica de Southern. Una
aplicación de la técnica de Northern es determinar si un gen específico se transcribe en
un cierto tejido o bajo unas determinadas condiciones ambientales.
Por tanto, el DNA clonado tiene muchas aplicaciones utilizado como sonda para
detectar un clon específico, un fragmento de DNA o una molécula de RNA. En todos
estos casos, nótese que la técnica explota la capacidad que tienen los ácidos nucleicos
de secuencia nucleotídica complementaria de encontrarse y unirse entre ellos.
Mensaje. Las técnicas de DNA recombinante que dependen de la complementariedad a
una sonda de DNA clonado incluyen los sistemas de transferencia e hibridación para la
identificación de clones específicos, fragmentos de restricción o mRNAs, así como para
la determinación del tamaño de DNAs o RNAs específicos.
Búsqueda de clones específicos mediante complementación funcional. En muchos
casos, no disponemos de una sonda para el gen con la que empezar, pero tenemos una
mutación recesiva en el gen de interés. Si podemos introducir DNA funcional dentro de
la especie que lleva este alelo recesivo (véase la Sección 20.6, Ingeniería genética), se
podrán detectar clones en una genoteca de bacterias o fagos por su capacidad de
23
restablecer la función eliminada por la mutación recesiva en ese organismo. Este
procedimiento se denomina complementación funcional o rescate de mutantes. El
esquema general del procedimiento es el siguiente:
Construir una genoteca de bacterias o fagos que contenga insertos de DNA donante
recombinante del tipo salvaje a+.
↓
Transformar células de la línea celular con la mutación recesiva a– utilizando el DNA de
clones individuales de la genoteca.
↓
Identificar los clones de la genoteca que producen células transformadas con el fenotipo
a+.
↓
Recuperar el gen a+ del clon bacteriano o fago obtenido.
Búsqueda de clones específicos basada en su localización en el mapa genético:
clonación posicional. La información sobre la posición de un gen en el genoma permite
evitar la ardua tarea de analizar una genoteca completa en busca de un clon de interés.
El término clonación posicional puede aplicarse a cualquier método para encontrar un
clon específico que haga uso de la información sobre la posición del gen dentro del
cromosoma. Para la clonación posicional se requieren dos elementos:
-
Marcadores genéticos que puedan establecer unos límites dentro de los cuales
podría encontrarse el gen. Si es posible, es mejor disponer de marcadores a ambos
lados del gen de interés, porque
24
(pág. 729)
(pág. 730)
así delimitan su posible localización. Estos marcadores pueden ser RFLPs
(polimorfismos en la longitud de fragmentos de restricción; del inglés, restriction
fragment length polymorphisms), SNPs (polimorfismos de un único nucleótido; del
inglés, single nucleotide polymorphisms) u otros polimorfismos moleculares
(véanse los Capítulos 4 y 13), incluso podría tratarse de puntos de rotura
cromosómicos bien cartografiados (véase el Capítulo 16).
-
La capacidad de investigar el segmento de DNA continuo que se extiende entre los
marcadores genéticos delimitantes. En los organismos modelo, se conocen los
genes contenidos en este bloque por la secuencia del genoma (véase el Capítulo 13).
A partir de estos genes, se pueden escoger candidatos que podrían ser el gen
buscado. En otras especies, se utiliza un proceso conocido como paseo
cromosómico para encontrar y ordenar los clones que caigan entre los marcadores
genéticos. La Figura 20-13 resume este procedimiento. La idea básica consiste en
usar la secuencia del marcador más cercano como sonda para identificar un segundo
grupo de clones que solape con el clon que contiene el marcador, pero que se
extiendan fuera de él en una de las dos direcciones (hacia el gen diana o alejándose
de él). Los fragmentos del extremo del nuevo conjunto de clones pueden ser
utilizados como sondas para identificar un tercer grupo de clones que solapen entre
ellos en la genoteca genómica. De esta manera, paso a paso, se puede analizar el
conjunto de clones que representa la región del genoma que se extiende a partir de
un marcador hasta determinar los clones que incluyen el gen diana, quizás mediante
el rescate de un mutante en el gen diana. Este proceso se denomina paseo
cromosómico porque consiste en una serie de pasos de un clon al siguiente clon
adyacente.
25
(pág. 730)
(pág. 731)
20.2 Amplificación de DNA in vitro: la reacción en cadena de la polimerasa
En el caso de que la secuencia de al menos algunas partes del gen o secuencia de interés
sea conocida, éstas se pueden amplificar en un tubo de ensayo en lugar de recurrir a la
clonación. Este procedimiento se denomina reacción en cadena de la polimerasa o
PCR (del inglés, polymerase chain reaction). La estrategia básica de la PCR está
resumida en la Figura 20-14. El proceso utiliza múltiples copias de un par de cebadores
cortos sintetizados químicamente, de 15 a 20 bases de longitud, que se unen cada uno a
un extremo diferente del gen o región que se quiere amplificar. Los dos cebadores se
unen uno a cada cadena del DNA, con sus extremos 3’ apuntándose el uno al otro. La
polimerasa añade bases a estos cebadores y el proceso de polimerización va y viene
entre ellos, formando un número de moléculas de DNA de doble cadena que crece
exponencialmente. A continuación, veremos el proceso en más detalle.
Se empieza con una solución que contiene la fuente de DNA, los cebadores, los
cuatro desoxirribonucleótidos trifosfato y una DNA polimerasa especial. El DNA es
desnaturalizado mediante calor, lo que resulta en moléculas de DNA de cadena simple.
Los cebadores hibridan con sus secuencias complementarias en estas moléculas de
DNA de cadena simple cuando se enfría la solución. Una DNA polimerasa especial
tolerante al calor replica los segmentos de DNA de cadena simple partiendo de un
cebador. La DNA polimerasa conocida como Taq polimerasa, de la bacteria Thermus
aquaticus, es la enzima utilizada normalmente. (Esta bacteria generalmente crece en
fumarolas termales y por tanto ha desarrollado proteínas que son extremadamente
resistentes al calor. Así puede sobrevivir a las altas temperaturas necesarias para
desnaturalizar el dúplex de DNA, y que desnaturalizarían e inactivarían la DNA
polimerasa de la mayoría de las especies). Esta enzima sintetiza nuevas cadenas
26
complementarias como en la replicación normal del DNA en las células, formando dos
moléculas de DNA de doble cadena idénticas a la molécula de doble cadena parental.
Estos pasos que llevan a una única replicación del segmento situado entre los dos
cebadores representan un ciclo.
(pág. 731)
(pág. 732)
Después de completar la replicación del segmento entre los dos cebadores, los
dos nuevos dúplex se desnaturalizan de nuevo al calentarse para generar moldes de
cadena simple, y se lleva a cabo un segundo ciclo de replicación bajando la temperatura
en presencia de todos los componentes necesarios para la polimerización. La repetición
de ciclos de desnaturalización, unión y síntesis resulta en un aumento exponencial en el
número de segmentos replicados. Se pueden conseguir amplificaciones de un millón de
veces en 1 ó 2 horas.
La gran ventaja de la PCR es que se necesitan menos procedimientos en
comparación con la clonación porque la localización de los cebadores determina la
especificidad del segmento de DNA que es amplificado. Si las secuencias que
corresponden a los cebadores están presentes sólo una vez en el genoma y están
suficientemente juntas (a una distancia máxima de unas 2 kb), el único segmento de
DNA que puede ser amplificado es el comprendido entre los dos cebadores. Esta
amplificación tendrá lugar incluso si el segmento de DNA se encuentra a
concentraciones muy bajas (como por ejemplo, una parte en un millón) en una mezcla
compleja de fragmentos de DNA como la generada por una preparación de DNA
genómico humano.
Como la PCR es una técnica muy sensible, tiene muchas aplicaciones en
biología. Mientras se usen cebadores específicos, esta técnica permite amplificar
secuencias diana presentes en un número de copias extremadamente bajo en una
27
muestra. Por ejemplo, los investigadores de crímenes pueden amplificar segmentos de
DNA humano a partir de unas pocas células foliculares alrededor del extremo de un
pelo arrancado.
Aunque la sensibilidad y especificidad de la PCR representan ventajas obvias, la
técnica tiene algunas limitaciones significativas. Para diseñar los cebadores, se debe
disponer de información sobre la secuencia de la porción de DNA que se quiere
amplificar; si no existe tal información, la PCR no puede aplicarse.
Mensaje. La reacción en cadena de la polimerasa utiliza cebadores diseñados
especialmente para la amplificación directa en un tubo de ensayo de regiones
específicas del DNA.
20.3 Determinación de la secuencia de bases de un segmento de DNA
Después de clonar el gen deseado o de haberlo amplificado mediante PCR, empieza la
labor de tratar de comprender su función. El lenguaje básico del genoma está compuesto
de ristras de los nucleótidos A, T, C y G. Obtener la secuencia nucleotídica completa de
un segmento de DNA es normalmente un paso importante para entender la organización
de un gen y su regulación, su relación con otros genes o la función del RNA o proteína
que codifica. Es más, generalmente, para descubrir la secuencia de aminoácidos de una
cadena polipeptídica es más simple traducir la secuencia de ácidos nucleicos de la
molécula de cDNA que lo codifica, que secuenciar directamente el propio polipéptido.
En esta sección se explicarán las técnicas utilizadas para obtener la secuencia de
nucleótidos del DNA.
Al igual que la tecnología del DNA recombinante y la PCR, la secuenciación de
DNA explota la complementariedad de bases junto con el conocimiento de la
28
bioquímica básica de la replicación del DNA. Se han desarrollado varias técnicas, pero
una de ellas es con diferencia la más utilizada. Se llama secuenciación didesoxi o
secuenciación Sanger, en honor a su inventor. El término didesoxi proviene de un
nucleótido modificado especial llamado didesoxinucleótido trifosfato (genéricamente,
ddNTP). Este nucleótido modificado es clave en la técnica de Sanger por su capacidad
de bloquear la continuación de la síntesis de DNA. ¿Qué es un didesoxinucleótido
trifosfato? ¿Y cómo bloquea la síntesis de DNA? Un didesoxinucleótido carece del
grupo 3’-hidroxilo así como del grupo 2’-hidroxilo, también ausente en un
desoxinucleótido
(pág. 732)
(pág. 733)
(Figura 20-15). Para que tenga lugar la síntesis de DNA, la DNA polimerasa debe
catalizar la reacción de condensación entre el grupo 3’-hidroxilo del último nucleótido
añadido a la cadena creciente y el grupo 5’-fosfato del siguiente nucleótido que va a ser
añadido, liberando agua y formado un enlace fosfodiéster con el átomo de carbono 3’
del azúcar adyacente. Como un didesoxinucleótido no tiene el grupo 3’-hidroxilo, esta
reacción no puede tener lugar, y por tanto la síntesis de DNA queda bloqueada en el
punto de adición del didesoxinucleótido.
La lógica de la secuenciación didesoxi es muy sencilla. Supongamos que
queremos leer la secuencia de un segmento de DNA clonado de, por ejemplo, 5000
pares de bases. Primero, se desnaturalizan las dos cadenas de este segmento. A
continuación, creamos un cebador para la síntesis de DNA que hibridará en una única
posición dentro del segmento de DNA clonado y entonces añadimos un “cóctel”
especial de DNA polimerasa, desoxinucleótidos trifosfato normales (dATP, dCTP,
dGTP y dTTP) y una pequeña cantidad de un didesoxinucleótido especial para una de
las cuatro bases (por ejemplo, didesoxiadenosina trifosfato, abreviado ddATP). La
29
polimerasa empezará a sintetizar la cadena complementaria de DNA empezando a partir
del cebador, pero parará en cualquier punto en que se incorpore un didesoxinucleótido
trifosfato a la cadena creciente en lugar del desoxinucleótido trifosfato normal.
Supongamos que la secuencia de DNA del segmento que estamos intentando secuenciar
es:
5’ ATGGGATAGCTAATTGTTTACCGCCGGAGCCA 3’
La síntesis de DNA empezaría a partir de un cebador complementario:
5’ ATGGGATAGCTAATTGTTTACCGCCGGAGCCA 3’
3’
CGGCCTCGGT 5’
← Dirección de la síntesis de DNA
Utilizando el cóctel especial con ddATP para la síntesis de DNA, se crean una
serie de fragmentos de DNA con el mismo punto de inicio pero diferentes puntos
finales, ya que los fragmentos acaban en cualquier punto en que la inserción de un
ddATP en lugar de dATP detuvo la replicación del DNA. El conjunto de diferentes
cadenas de DNA truncadas por el ddATP tiene el aspecto de la lista de secuencias
siguiente. (*A indica el didesoxinucleótido.)
5’ ATGGGATAGCTAATTGTTTACCGCCGGAGCCA 3’ Clon de DNA molde
3’
CGGCCTCGGT 5’ Cebador
← Dirección de la síntesis de DNA
*ATGGCGGCCTCGGT 5’ Fragmento didesoxi 1
30
*AATGGCGGCCTCGGT 5’ Fragmento didesoxi 2
*AAATGGCGGCCTCGGT 5’ Fragmento didesoxi 3
*ACAAATGGCGGCCTCGGT 5’ Fragmento didesoxi 4
*AACAAATGGCGGCCTCGGT 5’ Fragmento didesoxi 5
*ATTAACAAATGGCGGCCTCGGT 5’ Fragmento didesoxi 6
*ATCGATTAACAAATGGCGGCCTCGGT 5’ Fragmento didesoxi 7
*ACCCTATCGATTAACAAATGGCGGCCTCGGT 5’ Fragmento didesoxi 8
Se puede generar esta serie de fragmentos para cada uno de los cuatro posibles
didesoxinucleótidos trifosfato en cuatro reacciones separadas (una que incluya ddATP,
otra con ddCTP, otra con ddGTP y una última con ddTTP). Cada reacción producirá un
conjunto diferente de fragmentos pero en ninguna de las reacciones se producirán
fragmentos del mismo tamaño. Es más, si juntamos los resultados de las cuatro
reacciones, veremos que
(pág. 733)
(pág. 734)
los fragmentos se pueden ordenar en función de su longitud, con las longitudes
aumentando de base en base. Los pasos finales del proceso son:
1. Separar los fragmentos por orden de tamaño mediante electroforesis en gel.
Aparecerán en cuatro columnas separadas señaladas como C, A, G y T.
2. Marcar las cadenas sintetizadas de manera que se puedan visualizar después de que
se hayan separado según su tamaño por electroforesis. Esto se puede conseguir
(pág. 734)
(pág. 735)
31
marcando radioactivamente o con fluorescencia bien el cebador (marcaje de
iniciación) o los didesoxinucleótidos trifosfato (marcaje de terminación).
Los productos de las reacciones de secuenciación con didesoxinucleótidos se
muestran en la Figura 20-16. El resultado es una escalera de cadenas de DNA marcadas
que aumentan de tamaño una base cada peldaño. Por tanto, todo lo que hay que hacer es
leer el gel para leer la secuencia de DNA de la cadena sintetizada en la dirección de 5’ a
3’.
Si el marcaje es por fluorescencia y se ha utilizado un fluorocromo de diferente
color para cada una de las cuatro reacciones con ddNTP, entonces las cuatro se pueden
realizar en el mismo tubo y los cuatro conjuntos de cadenas de DNA pueden cargarse
juntos en el mismo carril para hacer la electroforesis. De este modo, se pueden producir
cuatro veces más secuencias en el mismo tiempo que si se hacen las reacciones por
separado. Esta lógica es utilizada en la detección de fluorescencia en las máquinas de
secuenciación automática de DNA. Gracias a estas máquinas, la secuenciación de DNA
puede realizarse de forma muy rápida y, aumentando la escala de todos los procesos
descritos en esta sección, se pueden obtener secuencias de genomas completos. La
Figura 20-17 muestra el resultado obtenido en un secuenciador automático. Cada pico
de color representa un fragmento de DNA de diferente tamaño que termina con una base
fluorescente detectada por el escáner fluorescente del secuenciador. Los cuatro colores
diferentes corresponden a las cuatro bases del DNA. La aplicación a escala genómica de
la tecnología de secuenciación automática es uno de los principales puntos tratados en el
Capítulo 13.
32
Mensaje. Un segmento de DNA clonado puede ser secuenciado mediante la
caracterización de una serie de fragmentos de DNA sintéticos truncados, terminado cada
uno en las diferentes posiciones en que ha tenido lugar la incorporación de un
didesoxinucleótido.
20.4 Análisis genético directo mediante clonación posicional
Gracias a la veloz acumulación de gran cantidad de recursos genómicos (por ejemplo,
secuencias genómicas completas, cartografía de polimorfismos en las poblaciones,
colecciones de marcadores moleculares), cada vez es más factible el aislamiento de
genes basándose únicamente en el conocimiento de su posición en un mapa genético. La
estrategia global se denomina clonación posicional y es ilustrada en esta sección
mediante dos casos prácticos.
(pág. 735)
(pág. 736)
La potencia de la clonación posicional reside en que tanto mutantes como
variantes naturales pueden ser utilizados como puntos de partida para el descubrimiento
de genes. En muchos casos, un genetista quiere inspeccionar el genoma en busca de
todos los genes que contribuyan en un proceso biológico concreto, por ejemplo, el
desarrollo del cerebro. En estos casos, después de mutagenizar una gran población de
genomas, el reto es cribar esta colección de individuos e identificar esos pocos con
fenotipos que parezcan tener una mutación que afecte el proceso de interés. El paso
siguiente para aislar el gen es determinar una posición aproximada del gen mutante en el
mapa. Una vez determinada esta posición, ya se puede aplicar la clonación posicional
para precisar la localización exacta del gen y, finalmente, su secuencia. Con esta
información disponible, el genetista frecuentemente ya puede encontrar qué hay de
incorrecto en el gen mutante y cuál es la función normal del gen salvaje. La clonación
33
posicional también ha sido una estrategia efectiva para comprender la base molecular de
la variación natural. En el ejemplo presentado más tarde en esta sección, se podrá ver
como se está utilizando la clonación posicional para identificar los genes seleccionados
por los nativos americanos en la domesticación del maíz a partir del teosinte, su
progenitor salvaje. Estos casos pueden ser considerados como genética directa, porque
el genetista analiza fenotipos heredables a nivel genético antes de realizar el análisis
molecular de mutantes o variantes.
Con las técnicas descritas en este capítulo y muchas otras, podemos ver como se
lleva a cabo un análisis genético directo, desde el rastreo de mutantes a la identificación
molecular de un gen.
1. Normalmente, un análisis genético directo empieza con el genoma salvaje, el cual es
mutado al azar con un mutágeno e inspeccionado sistemáticamente en busca de
mutaciones que tengan algún fenotipo en común. Este procedimiento se denomina a
veces caza de mutantes. Idealmente, el investigador identificará mutaciones en
literalmente todos los genes del genoma que puedan ser mutados para producir un
fenotipo particular. Entonces, se puede decir que el genoma ha sido saturado por
mutaciones de esa clase. Por ejemplo, el rastreo de mutantes fue un primer paso
importante en el aislamiento de los genes herramientas de Drosophila (véase el
Capítulo 12)
2. Se identifican mutantes causados por mutaciones en un único gen, tal como se
describe en el Capítulo 2.
3. Se sitúa el gen en una posición aproximada dentro del cromosoma con el uso de las
técnicas descritas en el Capítulo 4.
34
4. Se usan marcadores moleculares ligados al gen para aislar clones de una genoteca ya
existente o de una genoteca construida a propósito para el caso que nos ocupa.
5. Como los genomas de los organismos superiores son normalmente muy grandes (el
genoma humano, por ejemplo, tiene casi 3000 MB), los marcadores moleculares
ligados disponibles podrían estar aún a más de 1 millón de pares de bases del gen de
interés. En este caso, estos clones distantes sirven como punto de partida para
obtener marcadores moleculares adicionales en la región de interés (véase el
Capítulo 4).
6. Se buscan genes candidatos (ORFs) en la secuencia de DNA del clon seleccionado.
7. Se pueden usar una gran variedad de técnicas para determinar cual de los ORFs es el
gen diana.
Estos pasos se pueden aplicar tanto si está disponible la secuencia completa y
anotada del genoma del organismo estudiado como si no. Sin embargo, el proceso es
mucho más rápido y simple cuando se conoce la secuencia genómica completa, como es
el caso del ejemplo ilustrado en la siguiente sección.
Un análisis directo para identificar el gen causante de una enfermedad humana
A continuación, se explicarán los métodos usados para identificar la secuencia
genómica del gen de la fibrosis quística (FQ). En el momento en que el gen fue aislado
no se conocía ningún defecto bioquímico primario, y por tanto se trataba de un caso de
un gen en busca de una función.
(pág. 736)
(pág. 737)
Los rastreos genéticos se pueden utilizar para diseccionar cualquier proceso
biológico. Su efectividad depende únicamente del ingenio del investigador en el diseño
35
de un protocolo que revele la clase deseada de mutaciones. Sin embargo, los rastreos
genéticos no pueden realizarse en seres humanos, porque no se pueden crear mutantes
humanos intencionadamente. Por tanto, se realizan análisis de genealogías de grandes
familias con la enfermedad (el análisis de genealogías es descrito en el Capítulo 2)
cuando se dispone de esta información, para determinar la posición del defecto genético
causante de una enfermedad como la fibrosis quística o la enfermedad de Huntington.
Los miembros de una familia portadora de la enfermedad tendrán uno o más marcadores
moleculares en común que no se encuentran en otras familias (véase una discusión
sobre marcadores moleculares en el Capítulo 4). La localización del marcador
proporciona la posición aproximada del gen (paso 3 de la lista anterior).
El ligamiento a marcadores moleculares había situado el gen FQ en el brazo
largo del cromosoma 7, entre las bandas 7q22 y 7q31.1. Se pensaba que el gen FQ se
encontraba dentro de esta región, flanqueado por el gen met (un proto-oncogen; véase el
Capítulo 15) en un lado y un marcador molecular, D788, en el otro. Pero entre estos dos
marcadores, había 1.5 centimorgans (unidades de mapa) de cromosoma, una enorme
extensión no cartografiada de más de 1 millón de bases. Para acercarse, era necesario
generar más marcadores moleculares dentro de esta región. El método general para
aislar marcadores moleculares (descrito en el Capítulo 4) consiste en identificar una
región de DNA que sea polimórfica en individuos o poblaciones que difieren en el
carácter de interés. Al encontrar marcadores moleculares adicionales ligados al gen FQ,
los genetistas redujeron la región que contenía el gen FQ a unas 500 kbp, aún una
distancia considerable.
Entonces se elaboró un mapa físico completo de esta región; es decir, se colocó
en el orden correcto un conjunto al azar de clones de esta región. La ordenación de estos
clones requirió el uso de dos técnicas capaces de atravesar esta enorme distancia
36
genética: el paseo cromosómico y una técnica relacionada llamada salto cromosómico.
Esta última técnica proporciona un modo de saltar a través de áreas de DNA
potencialmente inclonables y genera marcadores ampliamente espaciados a lo largo de
la secuencia que pueden ser utilizados como puntos de partida para múltiples paseos
cromosómicos bidireccionales. Estos paseos cromosómicos sirven para ordenar los
clones tal como se muestra en la Figura 20-13. El salto cromosómico está representado
en la Figura 20-18. Finalmente, se secuenció el clon que contenía marcadores
moleculares más estrechamente ligados al carácter FQ, y se pudo empezar la búsqueda
de todos los genes situados en este fragmento de DNA que contenía tanto secuencias
génicas como no codificadoras.
Los genes candidatos fueron identificados por ciertas características comunes de
los genes, como islas CpG y señales de inicio o terminación (véase el Capítulo 13). En
el ejemplo de la FQ, las secuencias de genes candidatos y cDNAs se compararon entre
personas sanas y pacientes de FQ. Sólo el gen FQ contenía una mutación en todos los
pacientes de FQ analizados. La comparación de la secuencia de un cDNA de este gen
candidato en personas sanas y pacientes de FQ reveló una deleción de tres pares de
bases en los pacientes de FQ que eliminaba una fenilalanina de la proteína. A su vez, se
predijo la estructura tridimensional de la proteína a partir de la secuencia inferida del
gen. Esta proteína resultó ser estructuralmente similar a las proteínas de transporte de
iones de otros sistemas, lo que sugiere que un defecto en el transporte es la causa
principal de la FQ. Cuando se utilizó la secuencia del gen salvaje para transformar
líneas celulares mutantes de pacientes de FQ, se restableció la función
(pág. 737)
(pág. 738)
normal, así que este “rescate” fenotípico fue la confirmación final de que la secuencia
aislada era de hecho el gen FQ.
37
Los protocolos de paseo y salto cromosómicos son todavía estrategias útiles para
la clonación posicional en organismos para los que no se dispone de la secuencia de su
genoma. Este era el caso para el genoma humano en 1989 cuando se aisló el gen FQ.
Sin embargo, la disponibilidad de la secuencia genómica completa ha disminuido
drásticamente el tiempo necesario para identificar un gen de una enfermedad humana
haciendo que muchas técnicas laboriosas como el paseo y el salto cromosómico queden
obsoletas. En su lugar, las búsquedas informáticas de las bases de datos de la
información genómica humana sirven para identificar clones que contienen marcadores
moleculares y regiones adyacentes. Además, estas bases de datos incluyen información
sobre el contenido de genes de estas regiones (véase el Capítulo 13, en referencia a la
anotación), lo que permite a los genetistas identificar uno o más posibles genes
candidatos. Uno de estos genes puede ser reconocido como el gen de interés a través del
mismo tipo de técnicas utilizadas para identificar el gen FQ, como por ejemplo, la
comparación de las secuencias de los genes candidatos entre personas sanas y pacientes
de FQ.
Un análisis directo para identificar un gen importante en la domesticación del
maíz
(margen) QUÉ ESTÁN HACIENDO LOS GENETISTAS EN LA ACTUALIDAD
Como se ha mencionado al principio del capítulo, George Beadle propuso que, a pesar
de las destacadas diferencias morfológicas, la gramínea salvaje teosinte es el ancestro
del maíz domesticado moderno. Mediante la realización de miles de cruces genéticos
entre maíz y teosinte (cuyos híbridos son interfértiles) Beadle concluyó que tan sólo
cinco loci de caracteres cuantitativos (QTL, véanse los Capítulos 3 y 18) de efecto
mayor serían suficientes para explicar sus diferencias morfológicas (Figura 20-19).
38
El aislamiento de los genes que transformaron el teosinte en maíz ha sido de
gran interés, especialmente para el genetista John Doebley, quien ha escrito que el paso
crítico en la domesticación del maíz fue “la liberación del grano de la
(pág. 738)
(pág. 739)
envoltura protectora endurecida que lo envuelve en el teosinte”. Una envoltura dura
permite que la semilla de teosinte sea dispersada después de pasar a través del tracto
digestivo de un animal sin resultar dañada. Para ser útil como fuente de alimento, sin
embargo, una planta necesita tener una semilla expuesta que carezca de envoltura. El
QTL responsable de los “granos desnudos de maíz” se denomina tga1 (arquitectura de
la gluma del teosinte; del inglés, teosinte glume architecture). Basándose en cruces
genéticos, Doebley y sus colegas plantearon la hipótesis de que el alelo del maíz de tga1
(llamado Tga1-maize) produce granos desnudos, mientras que el alelo del teosinte
(llamado tga1) produce granos endurecidos.
Para aislar el gen tga1, Doebley en primer lugar tuvo que generar una línea de
maíz que contuviera la región del cromosoma del teosinte con el alelo de esta especie
(esta línea se denominó maize:tga1). En esta situación, se dice que el alelo del teosinte
está introgresado en el fondo genético del maíz. [De un modo similar, la región del
cromosoma del maíz que contiene Tga1-maize puede ser introgresada en el fondo
genético del teosinte (teosinte:Tga1-maize); Figura 20-20]. La línea maize:tga1 sirvió
entonces como punto de partida para una estrategia de clonación posicional. En
términos generales, la línea maize:tga1 difiere del maíz sólo en que contiene un trozo
del cromosoma del teosinte con su alelo tga1 (y varios genes más). Mediante la
comparación de los marcadores genéticos en las dos líneas, Doebley fue finalmente
capaz de aislar la diferencia entre ellas, es decir, el fragmento de cromosoma de teosinte
que contiene varios genes incluido tga1. El último paso, como en la mayoría de
39
estrategias de clonación posicional, consistió en determinar cuál de los genes en esta
región era tga1. Y, al igual que en otras estrategias de clonación posicional, esta
determinación se basó en un análisis comparativo de las secuencias de los alelos de
maíz y teosinte. Este análisis finalmente llevó a Doebley y sus colegas a identificar tga1
como un supuesto factor de transcripción (véase el Capítulo 11) que difería entre el
maíz y el teosinte en unos cuantos cambios de pares de bases que incluían una
diferencia en un aminoácido. Además, determinaron que las líneas con tga1 tienen más
proteína TGA1 en la mazorca en desarrollo que las líneas con Tga1-maize. La
investigación continuó hasta demostrar que esta diferencia era debida a una diferencia
en las regiones reguladoras del gen que estaban situadas más de 40 kb (40 000 pares de
base) aguas arriba del punto de inicio de la transcripción. Este descubrimiento les llevó
a formular la hipótesis de que las complejas diferencias entre las semillas recubiertas del
teosinte y los granos desnudos del maíz son el resultado de la expresión de variantes
alélicas diferentes de tga1. Es decir, el gen del maíz probablemente no es un alelo nulo
de tga1 sino una forma alternativa del gen que conduce a una forma alternativa de
desarrollo de la mazorca.
Las secciones anteriores han introducido las técnicas fundamentales que han
revolucionado la genética. Las dos secciones finales de este capítulo se centrarán en la
aplicación de estas técnicas al diagnóstico de enfermedades humanas y a la ingeniería
genética.
20.5 Detección de alelos causantes de enfermedades humanas: diagnóstico
mediante genética molecular
40
En más de 500 enfermedades genéticas humanas, como por ejemplo la alcaptonuria, uno
de los factores contribuyentes es un alelo mutante recesivo en un único gen. Para las
familias con riesgo de estas enfermedades es importante detectar a los futuros padres
heterocigóticos para permitir que puedan ser aconsejados. También es necesario ser
capaz de detectar tempranamente la descendencia homocigótica, idealmente en la etapa
fetal, para que los médicos puedan aplicar lo antes posible terapias dietéticas o
farmacológicas. En el futuro, podría incluso existir la posibilidad de la terapia génica.
Los desórdenes dominantes también requieren un diagnóstico genético. Por ejemplo, las
personas con riesgo para la enfermedad de Huntington de aparición tardía necesitan
saber si son portadoras del alelo de la enfermedad antes de tener hijos.
Diversas pruebas ampliamente utilizadas son capaces de detectar alelos
defectivos en homocigosis en células fetales. Las células fetales se obtienen del líquido
amniótico, se separan de los otros componentes y se cultivan para llevar a cabo el
análisis de cromosomas, proteínas, reacciones
(pág. 739)
(pág. 740)
enzimáticas y otras propiedades bioquímicas. Este proceso, la amniocentesis (Figura
20-21), puede identificar un cierto número de desórdenes conocidos. En la Tabla 20-1
se enumeran algunos ejemplos. La biopsia de corion (CVS; del inglés, chorionic villus
sampling) es una técnica relacionada en la que se aspira una pequeña muestra de células
de la placenta con una jeringa larga. Durante el embarazo la CVS se puede realizar antes
que la amniocentesis, que debe esperar al desarrollo de un volumen de líquido
amniótico suficiente.
Tradicionalmente, estos procedimientos han servido sólo para identificar
desórdenes que pueden ser detectados como un defecto químico en las células
cultivadas. Sin embargo, con la tecnología del DNA recombinante, se puede analizar el
41
DNA directamente. En principio, el gen fetal causante de la enfermedad podría ser
clonado y su secuencia comparada con la de un gen normal clonado para ver si el gen
fetal es normal. Sin embargo, este procedimiento sería largo y poco práctico, y por tanto
se han concebido métodos más rápidos y sencillos. Por ejemplo, como la PCR permite a
un investigador centrarse en cualquier gen deseado, se puede utilizar esta técnica para
amplificar y posteriormente secuenciar cualquier fragmento de DNA potencialmente
defectivo. En un método aún más simple, se pueden diseñar cebadores que hibriden con
el alelo normal y por tanto permitan su amplificación, pero que no hibriden con el alelo
mutante. Con esta técnica se pueden diagnosticar enfermedades causadas por la
presencia de una mutación específica.
Mensaje. La tecnología del DNA recombinante proporciona muchas técnicas sensibles
que son útiles para hacer pruebas de detección de alelos defectivos.
(pág. 740)
(pág. 741)
20.6 Ingeniería genética
Gracias a la tecnología del DNA recombinante, los genes se pueden aislar en un tubo de
ensayo y caracterizarse como secuencias nucleotídicas específicas. Pero incluso este
logro no es el final de la historia. A continuación veremos que el conocimiento de una
secuencia es con frecuencia el principio de toda una nueva serie de procesos de
manipulación genética. Cuando una secuencia ya está caracterizada, se puede manipular
para alterar el genotipo de un organismo. La introducción de un gen alterado en un
organismo se ha convertido en un aspecto central de la investigación genética básica,
pero también ha encontrado una amplia aplicación comercial. Dos ejemplos de esto
último son (1) cabras que secretan en su leche antibióticos derivados de un hongo y (2)
plantas protegidas de la congelación por la incorporación en su genoma de genes
42
“anticongelantes” de peces árticos. El uso de las técnicas del DNA recombinante para
de este modo alterar el genotipo y fenotipo se denomina ingeniería genética.
Las técnicas de ingeniería genética descritas en la primera parte de este capítulo
fueron desarrolladas originalmente en bacterias y tuvieron que ser extendidas a los
eucariotas modelo, los cuales constituyen una gran proporción de los organismos
modelo utilizados en la investigación. Los genes eucariotas normalmente aún se clonan
y secuencian en hospedadores bacterianos, pero al final son introducidos en un
eucariota, tanto en la misma especie donante original como en otra completamente
diferente. El gen transferido se denomina transgén, y el resultado de esta manipulación
es un organismo transgénico.
El transgén puede ser introducido dentro de una célula eucariota mediante un
cierto número de técnicas, incluidas las de transformación, inyección, infección
bacteriana o viral y bombardeo con partículas de tungsteno u oro recubiertas de DNA
(Figura 20-22). Cuando el transgén entra en una célula, es capaz de viajar al núcleo,
donde, para convertirse en parte estable del genoma, debe insertarse en un cromosoma o
(sólo en algunas especies) replicarse como parte de un plásmido. Si la inserción tiene
lugar, el transgén puede reemplazar al gen endógeno o insertarse ectópicamente, es
decir, en otras posiciones en el genoma. Los transgenes de otras especies generalmente
se insertan ectópicamente.
Mensaje. La transgénesis puede introducir material genético nuevo o modificado dentro
de células eucariotas.
Ahora pasaremos a ver algunos ejemplos en hongos, plantas y animales, así
como algunas tentativas de terapia génica humana.
43
Ingeniería genética en Saccharomyces cerevisiae
Es justo decir que S. cerevisiae es el modelo genético eucariótico más sofisticado.
Muchas de las técnicas utilizadas en la ingeniería genética eucariótica en general fueron
desarrolladas en levaduras, así que explicaremos brevemente las rutas generales de
transgénesis en levaduras.
Los vectores más simples de levaduras son los plásmidos integradores de
levaduras (YIps; del inglés, yeast integrative plasmids), derivados de plásmidos
bacterianos en que se ha insertado el DNA de levaduras de interés. Cuando son
introducidos por transformación en células de levadura, estos plásmidos se insertan en
los cromosomas de levadura, generalmente por recombinación homóloga con el gen
endógeno, mediante un entrecruzamiento simple o doble (Figura 20-23). Como
resultado, o bien se inserta el plásmido entero o el alelo diana es sustituido por el alelo
del plásmido. Esto último es un ejemplo de sustitución génica (en este caso, la
sustitución de un gen manipulado por el gen original de la célula de levadura). La
sustitución génica puede utilizarse para delecionar un gen o sustituir un alelo mutante
por su homólogo salvaje, o, a la inversa, para sustituir
(pág. 741)
(pág. 742)
un alelo salvaje por uno mutante. Estas sustituciones pueden ser detectadas mediante la
siembra de las células en un medio que seleccione para un alelo marcador del plásmido.
El origen de replicación bacteriano es diferente de los orígenes eucarióticos, por
lo que los plásmidos bacterianos no se replican en levaduras. Por tanto, la única manera
de que estos vectores puedan generar un genotipo modificado estable es que sean
integrados en los cromosomas de levadura.
44
Ingeniería genética en plantas
Debido a su importancia económica en la agricultura, muchas plantas han sido objeto de
análisis genéticos con la finalidad de desarrollar variedades mejoradas. La tecnología
del DNA recombinante ha introducido una nueva dimensión en este empeño porque las
modificaciones genómicas posibles mediante esta tecnología son prácticamente
infinitas. La diversidad genética ya no se consigue solamente mediante la selección de
variantes dentro de una determinada especie. Ahora se puede introducir DNA de otra
especie de planta, animal, o incluso de bacterias. En respuesta a estas nuevas
posibilidades, un sector de la opinión pública ha expresado su preocupación sobre que
la introducción de organismos modificados genéticamente (GMOs; del inglés,
genetically modified organisms) en el suministro de comida pueda producir problemas
de salud inesperados. La preocupación por los GMOs es una faceta del actual debate
público sobre los complejos temas de salud pública, seguridad, ética y educación
planteados por las nuevas técnicas genéticas.
El sistema del plásmido Ti. Un vector utilizado rutinariamente para producir plantas
transgénicas es el plásmido Ti, un plásmido natural derivado de una bacteria del suelo
llamada Agrobacterium tumefaciens. Esta bacteria causa lo que se conoce como
enfermedad de la agalla de la corona, en que la planta infectada produce crecimientos
descontrolados denominados tumores o agallas. Estas agallas normalmente se forman en
la base (corona) del tallo de la planta. La clave para la producción de un tumor es un
gran plásmido circular de DNA (200 kb), el plásmido Ti o inductor de tumores (del
inglés, tumor inducing).
(pág. 742)
(pág. 743)
45
Cuando la bacteria infecta una célula de la planta, una parte del plásmido Ti es
transferida e insertada, aparentemente de forma más o menos aleatoria, en el genoma de
la planta hospedadora (Figura 20-24). La región del plásmido Ti que se inserta en la
planta hospedadora se conoce como T-DNA o DNA transferido (del inglés, transfer
DNA). En la Figura 20-25 se muestra la estructura de un plásmido Ti. Los genes cuyos
productos catalizan esta transferencia del T-DNA se encuentran en una región del
plásmido Ti separada del propio T-DNA. La región del T-DNA codifica varias
funciones interesantes que contribuyen a la capacidad de la bacteria de crecer y
dividirse dentro de la célula vegetal. Estas funciones incluyen enzimas que contribuyen
a la producción del tumor y otras proteínas que dirigen la síntesis de unos compuestos
llamados opinas, que son sustratos importantes para el crecimiento de la bacteria. Una
opina importante es la nopalina. De hecho, las opinas son sintetizadas por las células de
la planta infectada, que expresan los genes de síntesis de opinas situados en la región TDNA transferida. Las opinas son importadas al interior de las células bacterianas del
tumor creciente y metabolizadas por enzimas de la bacteria codificadas por los genes de
la utilización de opinas en el propio plásmido Ti.
El comportamiento natural del plásmido Ti lo hace muy adecuado para el papel
de vector en ingeniería genética de plantas. Si se pudiera empalmar el DNA de interés
dentro del T-DNA, entonces el paquete completo se insertaría de forma estable en un
cromosoma vegetal. Este sistema ha sido diseñado para funcionar esencialmente de este
modo pero con algunas modificaciones necesarias. A continuación, examinaremos un
protocolo.
Los plásmidos Ti son demasiado grandes para ser manipulados fácilmente y no
pueden hacerse más pequeños de un modo sencillo porque contienen pocas dianas de
restricción únicas y porque gran parte del
46
(pág. 743)
(pág. 744)
plásmido es necesario para su replicación o para el proceso de infección y transferencia.
Por lo tanto, la modificación de un plásmido Ti se realiza en diversos pasos. Los
primeros pasos de clonación tienen lugar en E. coli, con el uso de un vector
intermediario considerablemente más pequeño que Ti. El vector intermediario con el
transgén se inserta dentro del T-DNA. Este vector intermediario puede entonces
recombinar con un segundo plásmido Ti atenuado o “desarmado”, formando un
plásmido cointegrado que se puede introducir dentro de una célula vegetal mediante
infección y transformación con Agrobacterium. Un elemento importante del plásmido
cointegrado es un marcador seleccionable que pueda servir para detectar las células
transformadas. La resistencia a la kanamicina es uno de estos marcadores.
Tal como muestra la Figura 20-26, las bacterias que contienen el plásmido
cointegrado se utilizan para infectar segmentos cortados de tejido vegetal, como discos
perforados en una hoja. En las células infectadas, cualquier material genético situado
entre las secuencias de T-DNA adyacentes puede insertarse en un cromosoma de la
planta. Si los discos de hoja se colocan en un medio que contenga kanamicina, las
únicas células vegetales que experimentarán división celular serán aquellas que hayan
adquirido el gen kanR introducido en el plásmido cointegrado. Las células
transformadas crecen formando una agrupación o callo que puede ser inducida a formar
brotes o raíces. Entonces estos callos se transfieren al suelo, donde se desarrollarán
como plantas transgénicas (véase la Figura 20-26). Normalmente, se inserta una única
copia de la región T-DNA en un determinado genoma, donde segregará en la meiosis
como un alelo mendeliano normal (Figura 20-27). La presencia del inserto puede ser
verificada mediante el rastreo del tejido
(pág. 744)
47
(pág. 745)
transgénico en busca de marcadores genéticos transgénicos o la presencia de nopalina, o
mediante transferencia de Southern usando una sonda de DNA purificado
correspondiente al T-DNA.
En la actualidad se utilizan plantas transgénicas portadoras de uno o varios genes
foráneos, incluyendo plantas cultivadas portadoras de genes que confieren resistencia a
ciertas plagas bacterianas o fúngicas, y se están desarrollando muchas más. Además, no
sólo se están manipulando las cualidades de las propias plantas, sino que, como los
microorganismos, las plantas también se están utilizando como “fábricas” de
producción de proteínas codificadas por genes foráneos.
Ingeniería genética en animales
La tecnología transgénica se está usando en la actualidad en muchos sistemas animales
modelo. Nos centraremos en los tres modelos animales más utilizados en investigación
genética básica: el nematodo Caenorhabditis elegans, la mosca de la fruta Drosophila
melanogaster y el ratón Mus musculus. En estos sistemas animales también pueden
aplicarse versiones diferentes de muchas de las técnicas explicadas hasta ahora.
Transgénesis en C. elegans. El método utilizado para introducir transgenes en C.
elegans es simple: los DNAs transgénicos se inyectan directamente dentro del
organismo, normalmente como plásmidos, cósmidos u otros tipos de DNAs clonados en
bacterias. La estrategia de la inyección viene determinada por la biología reproductora
del gusano. Las gónadas del gusano son sincitiales, lo que significa que hay muchos
núcleos dentro de la misma célula gonadal. Una célula sincitial constituye una gran
proporción de un brazo de la gónada, y la otra célula sincitial forma la mayor parte del
48
otro brazo (Figura 20-28a). Estos núcleos no se convertirán en células individuales hasta
la meiosis, cuando empiezan su transformación en huevos o esperma. Si se inyecta una
solución de DNA en la región sincitial de uno de los brazos, más de 100 núcleos son
expuestos al DNA transformante. Por casualidad, unos cuantos de estos núcleos
incorporarán el DNA (recuerde, la membrana nuclear se rompe en el curso de la
división, y por tanto el citoplasma en el cual se inyecta el DNA se vuelve continuo con
el
nucleoplasma).
Normalmente,
el
DNA
transgénico
forma
conjuntos
extracromosomales de múltiples copias (Figura 20-28b) que existen como unidades
independientes fuera de los cromosomas. Ocasionalmente, los transgenes se integrarán
en una posición ectópica en un cromosoma, también como un conjunto de copias.
(pág. 745)
(pág. 746)
Desafortunadamente, las secuencias se pueden desordenar dentro del grupo multicopia,
lo que complica el trabajo del investigador.
Transgénesis en D. melanogaster. La transgénesis en D. melanogaster requiere una
técnica más compleja pero evita las dificultades causadas por los grupos de múltiples
copias del transgén. Se realiza por un mecanismo diferente de los discutidos hasta este
momento, pues se basa en las propiedades de un elemento transponible llamado
elemento P y que actúa como vector. Los elementos transponibles son el tema principal
del Capítulo 14.
Para el propósito que nos ocupa, todo lo que necesitamos saber es que hay dos
tipos de elementos P (Figura 20-29a):
-
Un tipo de elemento, de 2912 pb de longitud, codifica una proteína llamada
transposasa que es necesaria para que se puedan mover los elementos P a nuevas
49
posiciones en el genoma. Recuerde que este tipo de elemento es denominado
“autónomo” porque puede transponerse a través de la acción de su propia enzima
transposasa.
-
La transposasa ha sido delecionada en el segundo tipo de elemento, que es, por
tanto, un elemento no autónomo. Un elemento no autónomo aún puede moverse a
una nueva localización genómica si la transposasa es suministrada por un elemento
autónomo. El único requerimiento es que el elemento no autónomo contenga los
primeros y los últimos 200 pb del elemento autónomo, que incluyen las secuencias
que la transposasa necesita para reconocerlo. Además, cualquier DNA insertado
entre los extremos de un elemento P no autónomo será también transpuesto.
Como con C. elegans, el DNA es inyectado en un sincitio, que en este caso es el
embrión de Drosophila en sus primeras etapas de desarrollo (Figura 20-29b). Más
concretamente, el DNA es inyectado en el lugar donde se forman las células de la línea
germinal, en el polo posterior del embrión. Los adultos que crecen a partir de un
embrión inyectado normalmente no expresarán el transgén pero contendrán algunas
células germinales transgénicas, y estas células expresarán el transgén en la
descendencia.
¿Qué tipo de vector contiene el DNA inyectado? Para producir Drosophila
transgénicas, se deben inyectar dos plásmidos bacterianos recombinantes separados.
Uno contiene el elemento P autónomo que suministra las secuencias codificadoras de la
transposasa. Éste es el plásmido ayudante. El otro es el vector del elemento P y lleva el
transgén. Este vector del elemento P contiene un elemento no autónomo modificado
formado por los extremos del elemento P y el trozo de DNA clonado que se quiere
incorporar como transgén en el genoma de la mosca insertado entre ellos. Una solución
50
de DNA que contenga los dos plásmidos se inyecta en el polo posterior del embrión
sincitial, y la transposasa de P expresada a partir del plásmido ayudante inyectado
catalizará la inserción del vector del elemento P en el genoma de la mosca. La
naturaleza de la reacción enzimática de la transposasa garantiza que una única copia del
elemento se inserte en un punto determinado (Figura 20-29c).
¿Cómo se puede detectar la descendencia que se desarrolló a partir de gametos
que incorporaron el DNA clonado? Normalmente se detectan porque expresan un alelo
transgénico salvaje dominante de un gen para el cual la cepa receptora lleva un alelo
mutante recesivo.
Como se mencionó en el Capítulo 13, los elementos transponibles son
ampliamente utilizados en transgénesis en plantas así como en insectos. Quizás el
ejemplo mejor conocido en plantas es el sistema del
(pág. 746)
(pág. 747)
elemento Ac descrito por primera vez en Zea mays (maíz), que ha sido perfeccionado
como vector de clonación para transgénesis en muchas plantas.
Transgénesis en M. musculus. Los ratones son los modelos más importantes para la
genética de mamíferos. Lo más interesante es que mucha de la tecnología desarrollada
en ratones es potencialmente aplicable a los humanos. Hay dos estrategias para la
transgénesis en ratones, cada una con sus ventajas y desventajas:
-
Inserciones ectópicas. Los transgenes se insertan al azar en el genoma,
generalmente como grupos o conjuntos desordenados formados por múltiples copias
del transgén.
51
-
Transgenia dirigida. La secuencia transgénica se inserta en una posición del
genoma ocupada por una secuencia homóloga. Es decir, el transgén sustituye a la
secuencia homóloga equivalente.
Inserciones ectópicas. Para insertar transgenes en posiciones al azar, el procedimiento
consiste simplemente en inyectar una solución con DNA clonado en bacterias dentro del
núcleo de un óvulo fertilizado (Figura 20-30a). Varios óvulos inyectados son
depositados en el oviducto de la hembra, donde algunos de ellos se desarrollarán para
formar crías de ratón. En una fase posterior, el transgén se integra en los cromosomas de
núcleos aleatorios. En algunas ocasiones, las células transgénicas forman parte de la
línea germinal, y, en estos casos, el embrión inyectado se convertirá en un ratón adulto
cuyas células germinales contienen el transgén insertado en alguna posición dentro de
uno de sus cromosomas (Figura 20-30b). Algunos de los descendientes de estos adultos
heredarán el transgén en todas sus células. En cada punto de inserción habrá múltiples
copias del gen, pero la localización, el tamaño y la estructura de estos grupos de
transgenes será diferente cada vez que ocurra una integración. Esta técnica origina
algunos problemas: (1) el patrón de expresión de los genes insertados aleatoriamente
podría ser anormal (lo que es denominado como efecto de posición) porque el contexto
cromosómico local carece de las secuencias reguladoras normales del gen, y (2) pueden
tener lugar reordenamientos en el DNA de estos grupos de múltiples copias del transgén
(lo que produce, en esencia, mutaciones en las secuencias). Sin embargo, esta técnica es
mucho más eficaz y menos laboriosa que la transgenia dirigida.
Transgenia dirigida. La transgenia dirigida permite a los investigadores eliminar o
modificar la función codificada por un gen. Un alelo mutante se puede reparar a través
52
de una sustitución génica en la cual un alelo salvaje sustituye uno mutante en su misma
localización cromosómica. La sustitución génica evita los efectos de posición y los
reordenamientos asociados con las inserciones ectópicas, ya que se inserta una sola
copia del gen en su contexto cromosómico normal.
La transgenia dirigida en el ratón se lleva a cabo en células madre embrionarias
(células ES; del inglés embryonic stem cells) cultivadas. En general, una célula madre
es una célula indiferenciada de un determinado órgano o tejido que
(pág. 747)
(pág. 748)
Figura
(pág. 748)
(pág. 749)
se divide asimétricamente para producir como descendientes una célula madre y una
célula que se diferenciará en un tipo celular terminal. Las células ES son células madre
especiales que se pueden diferenciar para formar cualquier tipo celular del cuerpo,
incluyendo, lo que es más importante, la línea germinal.
Para ilustrar el proceso de transgenia dirigida, miraremos como se consigue uno
de sus resultados habituales, a saber, la sustitución de un gen normal por un gen
inactivo. Esta inactivación génica dirigida se suele denominar noqueado de genes (del
inglés, knockout, fuera de combate). Primero, un gen interrumpido inactivo es clonado y
utilizado para reemplazar al gen funcional en un cultivo de células ES, produciendo
células ES que contienen el gen noqueado (Figura 20-31a). Las construcciones de DNA
con el gen defectivo son inyectadas en el núcleo de células ES cultivadas. El gen
defectivo se inserta con mucha más frecuencia en posiciones no homólogas (ectópicas)
que en las posiciones homólogas (Figura 20-31b), y por tanto el siguiente paso consiste
en seleccionar las pocas células en las cuales el gen defectivo ha sustituido el gen
53
funcional tal como se deseaba. ¿Cómo es posible seleccionar células ES que contienen
una sustitución génica rara? El investigador puede incluir en la construcción de DNA
alelos de resistencia a fármacos dispuestos de manera que las sustituciones puedan ser
distinguidas de las inserciones ectópicas. Se muestra un ejemplo en la Figura 20-31c.
En la segunda parte del procedimiento, las células ES que contienen una copia
del gen de interés interrumpido son inyectadas en un embrión en las primeras etapas de
desarrollo (Figura 20-32a). Los adultos que crecen a partir de estos embriones se cruzan
con ratones normales. Los descendientes resultantes son quiméricos, es decir, tienen
algunos tejidos derivados de las líneas originales y otros de las líneas ES transplantadas.
Estos ratones quiméricos se aparean entonces con sus hermanos para producir ratones
homocigotos con el noqueado en ambas copias del gen (Figura 20-32b). Los ratones que
contienen el transgén dirigido en todas sus células son identificados mediante sondas
moleculares de secuencias únicas del transgén.
Mensaje. Las técnicas de transgenia de la línea germinal han sido desarrolladas para
todas las especies eucarióticas bien estudiadas. Estas técnicas dependen de nuestra
comprensión de la biología reproductora de la especie receptora.
Terapia génica humana
El objetivo general de la terapia génica es atacar la base genética de las enfermedades
en su origen: “curar” o corregir una condición anormal causada por un alelo mutante
mediante la introducción de un alelo transgénico salvaje dentro de las células. Esta
técnica ha sido
(pág. 749)
(pág. 750)
Figura
54
(pág. 750)
(pág. 751)
aplicada con éxito en muchos organismos experimentales y tiene el potencial de corregir
en los humanos algunas enfermedades hereditarias, particularmente aquellas asociadas a
diferencias en un único gen. Aunque la terapia génica ha sido probada en varias de estas
enfermedades, hasta ahora no hay casos claros de éxito. Sin embargo, las implicaciones
de la terapia génica tienen tal alcance que esta aproximación merece ser considerada en
este capítulo.
Para entender este método, vamos a tener en cuenta un ejemplo que muestra
como la terapia génica corrigió una deficiencia de hormona del crecimiento en ratones
(Figura 20-33). Los ratones con la mutación recesiva little (lit) son enanos porque
carecen de una proteína (el receptor hormonal liberador de hormona del crecimiento o
GHRHR; del inglés growth-hormone-releasing hormone receptor) que es necesario para
inducir la secreción por parte de la pituitaria del ratón de la hormona del crecimiento al
el sistema circulatorio. El paso inicial para corregir esta deficiencia fue inyectar unas
5000 copias de una construcción
(pág. 751)
(pág. 752)
transgénica en cigotos homocigóticos lit/lit. Esta construcción era un fragmento de
DNA lineal de 5 kb que contenía las secuencias codificadoras de la hormona del
crecimiento de rata (RGH; del inglés, rat growth hormone) fusionadas con las
secuencias reguladoras del gen de la metalotioneína del ratón. Estas secuencias
reguladoras inducen la expresión de cualquier gen inmediatamente adyacente en
presencia de metales pesados. Entonces los cigotos fueron implantados en los úteros de
madres adoptivas, y las crías de ratón nacieron y crecieron. Aproximadamente un 1% de
los ratones recién nacidos resultaron ser transgénicos, y alcanzaron un mayor tamaño
55
cuando se les administraban metales pesados a lo largo del desarrollo. Un ratón
transgénico representativo se cruzó con una hembra homocigótica lit/lit. El pedigrí
resultante se muestra en la Figura 20-33a. Aquí podemos ver que en las generaciones
posteriores se producen ratones cuyos pesos son de dos a tres veces el peso de sus
parientes lit/lit (Figura 20-33b). Estos ratones más grandes son siempre heterocigóticos
en este pedigrí, demostrando que el transgén con la hormona del crecimiento de rata
actúa como un alelo dominante. Así pues, la introducción del transgén RGH consiguió
una “cura” en el sentido que la descendencia no mostraba el fenotipo alterado.
Este ejemplo concreto plantea algunas cuestiones importantes sobre el proceso
de terapia génica. El defecto genético ocurre en el gen que codifica GHRHR, un
regulador de la producción de la hormona del crecimiento del ratón. Sin embargo, la
terapia génica no es un intento de corregir el defecto original en el gen que codifica
GHRHR, sino que más bien la terapia génica funciona evitando la necesidad de
GHRHR y produciendo hormona del crecimiento mediante otra ruta, específicamente
mediante la introducción de un gen de la hormona del crecimiento de rata que no está
bajo el control de GHRHR. Este transgén se expresa bajo el control de un promotor
inducible y en tejidos donde GHRHR no es necesaria para la liberación de hormona del
crecimiento. (El lector puede preguntarse por qué se utilizó hormona del crecimiento de
rata en lugar de la de ratón. El gen recombinante de la hormona del crecimiento de rata
producía mRNA y proteína con secuencias que se podían distinguir de las versiones
correspondientes del ratón, y esto hacía que ambas moléculas pudieran ser medidas
directamente.)
A continuación dirigiremos nuestra atención a la situación actual de varias
aproximaciones técnicas. En humanos pueden aplicarse dos tipos básicos de terapia
56
génica: somática y germinal. El objetivo de la terapia génica en la línea germinal
(Figura 20-34a) es el más ambicioso: introducir células
(pág. 752)
(pág. 753)
transgénicas en la línea germinal así como en la población de células somáticas. Este
tipo de terapia no sólo conseguiría curar a la persona tratada, sino que también sus hijos
serían portadores del transgén terapéutico. La cura del defecto recesivo lit del ratón es
un ejemplo de terapia génica en la línea germinal. Actualmente, estas tecnologías
dependen de que la integración ectópica o la sustitución génica ocurran por casualidad,
y estos sucesos son tan infrecuentes que hacen que la terapia génica no sea viable por
ahora.
La terapia génica somática (Figura 20-34b) intenta corregir el fenotipo de una
enfermedad tratando algunas células somáticas de la persona afectada. Ningún transgén
entra en la línea germinal. En la actualidad, no es posible hacer transgénico el cuerpo
completo, y por tanto el método se dirige a enfermedades causadas por genes que son
expresados predominantemente en un tejido. En estos casos, es probable que no todas
las células de ese tejido necesiten convertirse en transgénicas, y que una porción de las
células con el transgén ya pueda mitigar los síntomas globales de la enfermedad. El
método consiste en extraer células de un paciente con el genotipo defectivo y
convertirlas en transgénicas mediante la introducción de copias del gen salvaje clonado.
Las células transgénicas se pueden entonces reintroducir en el cuerpo del paciente
donde proporcionarán la función génica normal.
Los virus se han utilizado como vectores para introducir DNA en los genomas
de muchos animales, incluidos los humanos. En el Capítulo 14 se estudió el uso de un
retrovirus que contenía el gen normal que codifica la adenosina desaminasa para tratar
la enfermedad de la inmunodeficiencia combinada grave (SCID, por sus siglas en
57
inglés) en niños humanos. Recuerde que algunos pacientes con SCID desarrollaban
leucemia después de la terapia génica, posiblemente como resultado de la inactivación
génica. Otro problema es que un retrovirus solamente infecta a las células proliferantes,
como las células sanguíneas, y por tanto no se pueden usar para tratar los muchos
desórdenes heredables que afectan tejidos cuyas células raramente o nunca se dividen.
Otro vector utilizado en terapia génica humana es el adenovirus. Este virus
normalmente infecta los epitelios respiratorios inyectando su genoma dentro de las
células epiteliales que revisten la superficie del pulmón. El genoma viral no se integra
en un cromosoma sino que persiste extracromosomalmente dentro de las células, lo que
elimina el problema de que el vector inactive un gen endógeno. Otra ventaja del
adenovirus como vector es que ataca a las células que no se dividen, y por tanto, en
principio muchos tejidos son susceptibles de ser infectados. El adenovirus es una
elección apropiada como vector para tratar la fibrosis quística, una enfermedad del
epitelio respiratorio. La terapia génica para la fibrosis quística se está ensayando
introduciendo los virus portadores del alelo salvaje de la fibrosis quística por vía nasal
con un pulverizador.
Aunque existen algunas razones para creer que los obstáculos técnicos de la
terapia génica somática serán superados, estos obstáculos son considerables. Un
problema es cómo dirigir la entrega del transgén al tejido apropiado para una
determinada enfermedad. Otro es cómo construir el transgén para asegurar unos niveles
de expresión altos y estables. Aún otra dificultad es cómo protegerse contra potenciales
efectos secundarios dañinos, como los que podrían ser causados por la expresión
incorrecta del gen transgénico. Estos puntos constituyen las principales áreas de
investigación en terapia génica.
58
Mensaje. Actualmente, las técnicas de transgénesis están siendo aplicadas en humanos
con el objetivo específico de utilizar la terapia génica para corregir ciertos desórdenes
heredables. Los retos técnicos, sociales y éticos de esta tecnología son considerables y
constituyen áreas activas de investigación y debate.
Resumen
El DNA recombinante se construye cortando el DNA donante en fragmentos que se
unen a un vector de DNA. Este vector de DNA es frecuentemente un plásmido
bacteriano o DNA viral. El DNA donante y el DNA del vector se cortan con la misma
endonucleasa de restricción en secuencias específicas. El DNA del vector y el donante
se unen en un tubo para formar enlaces covalentes fosfodiéster, creando un esqueleto
azúcar-fosfato intacto para cada cadena de DNA.
La construcción formada por el DNA donante y del vector se amplifica dentro de
células hospedadoras engañando a la maquinaria básica de replicación de la
(pág. 753)
(pág. 754)
célula para que replique las moléculas recombinantes. Así pues, el vector debe contener
todas las señales necesarias para su correcta replicación y segregación en la célula
hospedadora. En los sistemas basados en plásmidos, el vector debe incluir un origen de
replicación y marcadores seleccionables que confieran, por ejemplo, resistencia a
fármacos y que puedan ser utilizados para asegurar que el plásmido no se pierde en la
célula hospedadora. En los bacteriófagos, el vector debe incluir todas las secuencias
necesarias para llevar al bacteriófago (y al DNA foráneo asociado) a través del ciclo de
crecimiento lítico. El resultado de la amplificación son múltiples copias de cada
construcción de DNA recombinante denominadas clones.
59
A menudo, la búsqueda de un clon específico requiere el rastreo de una genoteca
genómica completa. Una genoteca genómica es un conjunto de clones, empaquetados en
el mismo vector, que en total representan todas las regiones del genoma del organismo
en cuestión. El número de clones que constituyen una genoteca genómica depende de
(1) el tamaño del genoma en cuestión y (2) el tamaño de inserto tolerado por el vector
de clonación utilizado. Del mismo modo, una genoteca de cDNA es una representación
del conjunto total de mRNAs producidos por un determinado tejido o etapa del
desarrollo en un organismo determinado. La comparación de una región genómica y su
cDNA puede servir para conocer las posiciones del inicio y terminación de la
transcripción y de los límites entre intrones y exones.
Las sondas marcadas de DNA o RNA de cadena simple actúan como un “cebo”
para pescar secuencias similares o idénticas en mezclas complejas de moléculas, tanto
en genotecas genómicas o de cDNA como en transferencias de Southern o Northern. El
principio general de la técnica para identificar clones o fragmentos de DNA en un gel es
crear una “imagen” de las colonias o calvas de un cultivo en una placa de Petri, o de los
ácidos nucleicos que se han separado en la matriz de un gel mediante la aplicación de un
campo eléctrico. El DNA o RNA entonces se desnaturaliza y se mezcla con una sonda
también desnaturalizada y marcada radioactivamente o con un fluorocromo. Después de
lavar la sonda que no se ha unido, se detecta la localización de la sonda mediante
observación de la fluorescencia o, si es radioactiva, por la exposición de la muestra a
una película de rayos X. Las localizaciones de la sonda corresponden a las posiciones
del DNA o RNA pertinente en la placa de Petri o el gel de electroforesis originales.
La reacción en cadena de la polimerasa es un método potente para la
amplificación directa de una secuencia relativamente pequeña de DNA a partir de una
mezcla compleja de DNA, sin la necesidad de una célula hospedadora o demasiado
60
material de partida. La clave es tener cebadores que sean complementarios a las
regiones flanqueantes en cada una de las dos cadenas de DNA. Estas regiones actúan
como puntos de inicio para la polimerización. Múltiples rondas de desnaturalización,
unión de los cebadores y polimerización permiten amplificar la secuencia de interés de
forma exponencial.
Los vastos recursos genómicos posibilitan cada vez más el aislamiento de genes
tan sólo a partir del conocimiento de su posición en un mapa genético. El proceso global
es una estrategia genética directa denominada clonación posicional. Tanto mutantes
como variantes naturales se han utilizado como punto de partida en el descubrimiento
de genes. Con la secuenciación del genoma humano y la disponibilidad de familias con
desórdenes heredados, las estrategias de clonación posicional han llevado al aislamiento
de genes que cuando están mutados producen enfermedades humanas, como la fibrosis
quística. Las estrategias de clonación posicional también se han usado para aislar
muchos otros genes, por ejemplo, los genes seleccionados durante la domesticación de
plantas de cultivo como el maíz.
Los transgenes son moléculas de DNA manipuladas que son introducidas y
expresadas en células eucarióticas. Pueden utilizarse para crear una nueva mutación o
para estudiar las secuencias reguladoras que forman parte de un gen. Los transgenes
pueden introducirse como moléculas extracromosomales o pueden integrarse en un
cromosoma, tanto en posiciones aleatorias (ectópicas) como en el lugar del gen
homólogo, según el sistema. Normalmente, los mecanismos utilizados para introducir
un transgén dependen del conocimiento y la explotación de la biología reproductora del
organismo.
La terapia génica es la extensión de la tecnología transgénica aplicada al
tratamiento de enfermedades humanas. Para corregir la enfermedad, la terapia génica en
61
células somáticas intenta introducir en tejidos somáticos específicos un transgén que o
bien sustituye al alelo mutante o suprime el fenotipo mutante. La terapia génica en la
línea germinal intenta introducir un transgén en la línea germinal que corrija el defecto
mutante o lo evite.
Términos clave
amniocentesis (pág. 740)
anticuerpo (pág. 727)
autorradiografía (pág. 725)
biopsia de corion (pág. 740)
clonación de DNA (pág. 716)
clonación posicional (pág. 729)
complementación funcional (rescate de mutantes) (pág. 729)
cósmido (pág. 721)
cromosoma artificial bacteriano (BAC) (pág. 722)
cromosoma artificial de levadura (YAC) (pág. 722)
cromosoma artificial P1 (PAC) (pág. 722)
DNA complementario (cDNA) (pág. 717)
DNA donante (pág. 716)
DNA ligasa (pág. 720)
DNA recombinante (pág. 716)
efecto de posición (pág. 747)
electroforesis en gel (pág. 727)
elemento transponible (pág. 746)
enzima de restricción (pág. 717)
62
fragmento de restricción (pág. 718)
genética directa (pág. 736)
genómica (pág. 716)
genoteca de cDNA (pág. 724)
(pág. 754)
(pág. 755)
genoteca genómica (pág. 724)
hibridación (pág. 718)
ingeniería genética (pág. 716)
noqueado (pág. 749)
organismo modificado genéticamente (GMO) (pág. 742)
organismo transgénico (pág. 741)
paseo cromosómico (pág. 730)
plásmido Ti (pág. 742)
reacción en cadena de la polimerasa (PCR) (pág. 731)
rescate de mutantes (complementación funcional) (pág. 729)
secuencia palindrómica (pág. 718)
secuenciación didesoxi o Sanger (pág. 732)
sesgo en el uso de codones (pág. 717)
sonda (pág. 725)
sustitución génica (pág. 747)
tecnología del DNA (pág. 716)
terapia génica en la línea germinal (pág. 752)
terapia génica somática (pág. 753)
transferencia de Northern (pág. 729)
transferencia de Southern (pág. 728)
63
transgén (pág. 741)
transposasa (pág. 746)
vector (pág. 716)
Problemas resueltos
Problema resuelto 1. En el Capítulo 9, se estudió la estructura de las moléculas de
tRNA. Imagine que quiere clonar un gen fúngico que codifica un cierto tRNA. Dispone
de una muestra del tRNA purificado y de un plásmido de E. coli que contiene un único
sitio de corte para EcoRI dentro de un gen tetR (resistencia a la tetraciclina), así como un
gen de resistencia a la ampicilina (ampR). ¿Cómo se puede clonar el gen de interés?
SOLUCIÓN
Se puede usar el propio tRNA o una copia de su cDNA clonado como sonda para
detectar el gen de interés en el DNA. Un método consiste en digerir el DNA genómico
con EcoRI y entonces mezclarlo con el plásmido, también cortado con EcoRI. Después
de la transformación en una célula receptora ampS tetS, se seleccionan las colonias
AmpR, que indican una transformación exitosa. Dentro de estas colonias AmpR, se
seleccionan las que también son TetS. Estas colonias TetS contendrán vectores con
insertos en el gen tetR, y será necesario un gran número de ellas para hacer una
genoteca. Rastree la genoteca utilizando el tRNA como sonda. Los clones que hibriden
con la sonda contendrán el gen de interés.
Como alternativa, puede someter el DNA genómico digerido con EcoRI a una
electroforesis en gel para luego identificar la banda correcta utilizando el tRNA como
sonda. Esta región del gel se puede cortar y utilizar como una fuente enriquecida de
64
DNA para clonar en el plásmido cortado con EcoRI. Por último, se rastrean estos clones
con el tRNA para confirmar que contienen el gen de interés.
Problemas
PROBLEMAS BÁSICOS
1. Basándose en este capítulo, haga una lista de todos los ejemplos de (a) hibridación
de DNAs de cadena simple y (b) proteínas que se unen al DNA para realizar su
función.
2. ¿Para qué se usa el hidróxido de sodio en la síntesis de cDNA?
3. Compare y contraste el uso de la palabra recombinante en las frases (a) DNA
recombinante y (b) frecuencia de recombinantes.
4. ¿Por qué se necesita la enzima ligasa para hacer DNA recombinante? ¿Cuál sería la
consecuencia inmediata en el proceso de clonación si alguien se olvidara de
añadirla?
5. En el proceso de la PCR, si asumimos que cada ciclo tarda 5 minutos, ¿cuántas
veces se podría amplificar un fragmento de DNA en 1 hora?
6. Gracias a la secuencia del genoma completo, se conoce la posición del gen de la
proteína actina en el hongo haploide Neurospora. Si tuviera un mutante de
crecimiento lento que sospechara que es un mutante en el gen de la actina y quisiera
verificarlo, ¿qué haría, (a) clonar el mutante utilizando dianas de restricción bien
65
situadas que flanqueen el gen de la actina y entonces secuenciarlo o (b) amplificar la
secuencia mutante mediante PCR y luego secuenciarla?
7. Un investigador obtiene la secuencia de DNA de un mutante en un gen de 2 kb en el
que está interesado y encuentra diferentes bases en tres posiciones, todas en
diferentes codones. Uno es un cambio silencioso, pero los otros dos son mutaciones
de cambio de sentido (codifican nuevos aminoácidos). ¿Cómo demostraría que estos
cambios son mutaciones reales y no errores de secuenciación? (Asuma que la
secuenciación tiene un 99.9% de precisión).
8. En la transformación mediante T-DNA de una planta con un transgén de un hongo
(que no se encuentra en plantas), la presunta planta transgénica no expresa el
fenotipo esperado del transgén. ¿Cómo demostraría que en realidad la planta
contiene el transgen?
9. ¿Cómo produciría un ratón que sea homocigótico para un transgén de una hormona
del crecimiento de rata?
10. ¿Por qué se utilizó cDNA y no DNA genómico en la clonación comercial del gen de
la insulina humana?
(pág. 755)
(pág. 756)
11. Después de tratar DNA de Drosophila con una enzima de restricción, los
fragmentos son insertados dentro de plásmidos y seleccionados como clones en E.
coli. Con el uso de esta técnica “al azar”, cualquier secuencia de DNA de
Drosophila puede recuperarse de una genoteca.
66
a. ¿Cómo identificaría un clon que contenga el DNA que codifica la proteína
actina, cuya secuencia aminoacídica es conocida?
b. ¿Cómo identificaría un clon que codifique un tRNA específico?
12. En cualquier célula eucariota transformada (por ejemplo, de Neurospora), explique
cómo podría saber si el DNA transformante (colocado dentro de un vector
bacteriano circular)
a. ha reemplazado al gen endógeno en el receptor mediante un doble
entrecruzamiento o uno simple.
b. fue insertado ectópicamente.
13. En un gel de electroforesis a través del cual es aplicado un campo eléctrico pulsante
alterno, el DNA del hongo haploide Neurospora crassa (n = 7) se mueve lentamente
pero al final forma siete bandas, que representan fracciones de DNA de diferentes
tamaños y que, por tanto, se han movido a diferentes velocidades. Se supone que
estas bandas son los siete cromosomas. ¿Cómo demostraría qué banda corresponde
a cada cromosoma?
14. La proteína codificada por el gen de la alcaptonuria tiene 445 aminoácidos de
longitud, aunque el gen se extiende a lo largo de 60 kb. ¿Cómo es posible esta
diferencia?
15. En levaduras, un investigador ha secuenciado un trozo de DNA salvaje que
claramente contiene un gen, pero no sabe de qué gen se trata. Para investigarlo, le
gustaría encontrar su fenotipo mutante. ¿Cómo utilizaría el gen salvaje clonado para
67
conseguirlo? Explique claramente todos los pasos experimentales.
PROBLEMAS PARA PENSAR
16. La prototrofia es frecuentemente el fenotipo seleccionado para detectar
transformantes. Las células prototróficas se usan para extraer el DNA donante;
entonces este DNA se clona y los clones se añaden a un cultivo de un recipiente
autotrófico. Los transformantes que han tenido éxito se identifican sembrando el
cultivo recipiente en un medio mínimo y buscando colonias. Explique qué diseño
experimental usaría para asegurarse de que una colonia que espera que sea un
transformante no sea de hecho,
a. una célula prototrófica que ha contaminado el cultivo recipiente.
b. un revertiente (una segunda mutación en el gen originalmente mutante que
revierte el fenotipo de nuevo a prototrofia) de la mutación autotrófica.
17. Se investiga en dos niños la expresión de un gen (D) que codifica una enzima
importante para el desarrollo muscular. Los resultados de los estudios del gen y sus
productos son los siguientes:
(pág. 756)
(pág. 757)
Para el niño 2, la actividad de la enzima en cada etapa era muy baja y su valor
estimado era de aproximadamente 0.1 unidad en las edades de 1, 2, 3 y 4 años.
a. Para ambos niños, dibuje gráficos representando la expresión del gen a lo
largo del desarrollo. (Indique con claridad qué se representa en cada eje.)
b. ¿Cómo explicaría los niveles tan bajos de enzima activa en el niño 2? (La
degradación de la proteína es sólo una posibilidad.)
c. ¿Cómo explicaría las diferencias entre ambos niños en los resultados del
68
análisis mediante transferencia de Southern?
d. Si sólo se ha detectado un alelo mutante en los estudios de familia de los dos
niños, defina a cada uno de los niños como homocigoto o heterocigoto para
el gen D.
(El Problema 17 es cortesía de Joan McPherson. De A. J. F. Griffiths and J.
McPherson, 1001 Principles of Genetics. W. H. Freeman and Company, 1989.)
18. Un fragmento clonado de DNA fue secuenciado utilizando el método didesoxi. Una
parte de la autorradiografía del gel de secuenciación está representada a
continuación.
a. Deduzca la secuencia nucleotídica de la cadena de DNA sintetizada a partir
del cebador inicial. Marque los extremos 5’ y 3’.
b. Deduzca la secuencia nucleotídica de la cadena de DNA utilizada como
molde. Marque los extremos 5’ y 3’.
c. Escriba la secuencia nucleotídica de la doble hélice de DNA (marque los
extremos 5’ y 3’).
d. ¿Cuántos de los seis marcos de lectura están “abiertos” en este pequeño
fragmento?
19. El clon de cDNA del gen humano que codifica la tirosinasa fue marcado
radioactivamente y utilizado en un análisis mediante Southern de DNA genómico de
ratones salvajes digerido con EcoRI. Tres fragmentos de ratón resultaron ser
radioactivos (tenían la sonda unida). Cuando se utilizaron ratones albinos en este
análisis por Southern, ningún fragmento genómico se unió a la sonda. Explique
estos resultados en relación a la naturaleza de los alelos salvaje y mutante de ratón.
69
20. Se obtuvieron plantas transgénicas de tabaco en las que el vector plásmido Ti fue
diseñado para insertar el gen de interés más un gen adyacente de resistencia a la
kanamicina. Se siguió la herencia de la inserción cromosómica sometiendo a la
descendencia a una prueba para detectar la resistencia a kanamicina. Dos plantas
representan los resultados generales obtenidos. Cuando la planta 1 se retrocruzó con
tabaco salvaje, el 50% de los descendientes eran resistentes a la kanamicina y el
50% eran sensibles a este antibiótico. Cuando la planta 2 se retrocruzó con el tipo
salvaje, el 75% de la descendencia era resistente a la kanamicina y el 25% sensible.
¿Cuál debe ser la diferencia entre las dos plantas transgénicas? ¿Qué podría predecir
respecto a la situación del gen de interés?
21. Una mutación causante de fibrosis quística en una cierta genealogía se debe al
cambio de un único par de bases. Este cambio elimina una diana de restricción
EcoRI que se encuentra normalmente en esta posición. ¿Cómo podría utilizar esta
información para aconsejar a los miembros de esta familia sobre sus probabilidades
de ser portadores? Plantee los experimentos necesarios. Asuma que encuentra que
una mujer de esta familia es portadora, y resulta que está casada con un hombre no
emparentado que también es heterocigótico para la fibrosis quística, pero en este
caso, tiene una mutación diferente en el mismo gen. ¿Cómo aconsejaría a esta pareja
sobre los riesgos de tener un hijo con fibrosis quística?
22. La glucuronidasa bacteriana convierte una sustancia incolora llamada X-Gluc en un
pigmento de un color azul añil brillante. El gen de la glucuronidasa también
funciona en plantas si se le incorpora una región promotora de plantas. ¿Cómo
70
usaría este gen como gen informador para encontrar los tejidos en los cuales un gen
de planta que acaba de clonar es activo normalmente? (Asuma que el X-Gluc
penetra fácilmente en los tejidos vegetales.)
23. La planta Arabidopsis taliana fue transformada utilizando un plásmido Ti en que se
había insertado un gen de resistencia a la kanamicina en la región T-DNA. Se
seleccionaron dos colonias resistentes a la kanamicina (A y B) y se generaron
plantas a partir de ellas. Las plantas se dejaron autopolinizar y los resultados fueron
los siguientes:
Planta A autopolinizada →
3/4 descendencia resistente a kanamicina
1/4 descendencia sensible a kanamicina
Planta B autopolinizada →
15/16 descendencia resistente a kanamicina
1/16 descendencia sensible a kanamicina
a. Dibuje los cromosomas relevantes de la planta en los dos casos.
b. Explique las dos proporciones diferentes.
(pág. 757)
71
PIES DE FIGURAS
Figura inicial
Inyección de DNA foráneo en una célula animal. A la derecha, se observa la microaguja
utilizada para la inyección, y a la izquierda, la pipeta que mantiene a la célula sujeta.
[Copyright M. Baret/Photo Researchers].
Figura 20-1 El progenitor del maíz domesticado
Una subespecie de teosinte, Zea mays ssp. parviglumis crece en un barranco cerca de
Teloloapan en la cuenca del río Balsas en Guerrero, México.
Figura 20-2 Formación de una molécula de DNA recombinante
Las enzimas de restricción se utilizan para generar DNA recombinante. La enzima de
restricción EcoRI corta una molécula circular de DNA que tiene una diana de
restricción para dicha enzima, dando lugar a una molécula lineal con extremos
cohesivos de cadena simple. Debido a su complementariedad, otras moléculas lineales
con extremos cohesivos generados por el corte con EcoRI pueden hibridar con el DNA
circular linealizado y formar una molécula de DNA recombinante.
Figura 20-3 Inserción de un gen dentro de un plásmido de DNA recombinante
Método para generar un plásmido de DNA recombinante portador de genes derivados
de un DNA donante. [Según S. N. Cohen, The Manipulation of Genes. Copyright 1975
de Scientific American, Inc. Reservados todos los derechos.]
Figura 20-4 Cómo funciona la amplificación
72
Estrategia general usada para clonar un gen. El tratamiento del DNA donante y del
vector con enzimas de restricción permite la inserción de fragmentos individuales en el
vector. Tras la entrada de una sola molécula recombinante en la célula bacteriana, la
replicación y la división celular producen un número elevado de copias del fragmento
donante.
Figura 20-5 Un vector plasmídico, pUC18
El vector plasmídico pUC18 ha sido diseñado para su uso como vector de clonación de
DNA. La inserción en pUC18 se detecta por la inactivación de la función βgalactosidasa de lacZ’, que se traduce en la incapacidad para convertir el sustrato
artificial X-Gal en un compuesto de color azul. El sitio de clonación múltiple tiene
varias dianas de restricción alternativas en las que se puede insertar el DNA donante.
Figura 20-6 Clonación en el fago λ
Para clonar en el fago λ se elimina una región central del cromosoma del fago que no es
esencial y los extremos se ligan al azar con fragmentos de DNA donante de 15 kb. Se
forma un multímero lineal (concatenado), que es utilizado para rellenar las cápsides de
los fagos de monómero en monómero mediante un sistema de empaquetamiento in
vitro. [Según J. D. Watson, M. Gilman, J. Witkowski y M. Zoller. Recombinant DNA.
2ª edición. Copyright 1992 de Scientific American Books.]
Figura 20-7 Estructura de un vector BAC
Un cromosoma artificial bacteriano (BAC) se utiliza para clonar fragmentos grandes de
DNA donante. CMR es un marcador seleccionable de resistencia al cloramfenicol. oriS,
repE, parA y parB son genes del plásmido F para la replicación y la regulación del
73
número de copias. cosN es el sitio cos de un fago λ. HindIII y BamHI son sitios de
clonación en los que se puede insertar el DNA donante. Los dos promotores permiten
transcribir el fragmento insertado. Las dianas NotI se utilizan para liberar el fragmento
insertado. F = plásmido F.
Figura 20-8 Métodos para introducir el DNA recombinante dentro de células
bacterianas
El DNA recombinante puede ser introducido dentro de células bacterianas mediante
transformación, transducción o infección con un fago. (a) Un vector plasmídico es
introducido por transformación de DNA. (b) Ciertos vectores como los cósmidos son
introducidos dentro de cápsides de bacteriófago (transducción); sin embargo, después de
ser inyectados dentro de la bacteria, forman círculos y se replican como grandes
plásmidos. (c) Los bacteriófagos como el fago λ infectan y lisan la bacteria liberando un
clon de fagos descendientes, todos portadores de una molécula de DNA recombinante
idéntica dentro de su genoma.
Figura 20-9 Búsqueda del clon de interés mediante el uso de sondas de DNA o
RNA
El clon que contiene un gen de interés es identificado rastreando una genoteca
genómica, en este caso hecha por clonación de los genes en bacteriófagos λ, con una
sonda de DNA o RNA que se sabe que está relacionada con el gen deseado. Una sonda
radioactiva hibridará con cualquier DNA recombinante con una secuencia
complementaria, y revelará la posición del clon que contiene este DNA en una
autorradiografía. Entonces, el gen deseado se puede seleccionar en el espacio
correspondiente de la placa de Petri y transferir a un nuevo hospedador bacteriano para
74
poder ser aislado en estado puro. [Según R. A. Weinberg, A Molecular Basis of Cancer
y P. Leder, The Genetics of Antibody Diversity. Copyright 1983, 1982 de Scientific
American, Inc. Reservados todos los derechos.]
Figura 20-10 Búsqueda del clon de interés mediante el uso de anticuerpos
Para encontrar el clon de interés, se rastrea una genoteca de expresión construida con un
fago λ especial llamado λgt11 como vector con un anticuerpo específico de una
proteína. Después de eliminar de la membrana los anticuerpos que no se hayan unido,
los anticuerpos retenidos se detectan mediante la unión de un anticuerpo secundario
radioactivo. [Según J. D. Watson, M. Gilman, J. Witkowski y M. Zoller, Recombinant
DNA, 2ª edición. Copyright 1992 de Scientific American Books.]
Figura 20-11 Electroforesis en gel
Diversas mezclas de fragmentos de DNA de diferentes tamaños se han separado por
electroforesis en un gel de agarosa. Las muestras son cinco vectores recombinantes
tratados con EcoRI. Las mezclas se depositan en pocillos situados en la parte superior
del gel, y los fragmentos se mueven bajo la influencia de un campo eléctrico hasta
posiciones diferentes dependiendo de su tamaño (y, por lo tanto, del número de cargas).
Las bandas de DNA se han visualizado mediante tinción con bromuro de etidio y
fotografía bajo luz ultravioleta. (La letra “M” representa los carriles que contienen
marcadores de tamaño para estimar la longitud de los fragmentos de DNA.) [De H.
Lodish, D. Baltimore, A. Berk, S. L. Zipursky, P. Matsudaira y J. Darnell, Molecular
Cell Biology, 3ª edición. Copyright 1995 de Scientific American Books.]
75
Figura 20-12 Búsqueda de ácidos nucleicos específicos mediante el uso de
electroforesis en gel y transferencia
Para identificar ácidos nucleicos específicos separados por electroforesis en un gel se
utiliza una sonda radioactiva. Para empezar, el RNA o los fragmentos de restricción del
DNA son depositados en un gel de agarosa que se somete a electroforesis. Los diversos
fragmentos migran a diferentes velocidades según sus respectivos tamaños. A
continuación, se coloca el gel en un tampón y se cubre con una membrana y un montón
de servilletas de papel. Los fragmentos se desnaturalizan para convertirlos en cadenas
simples que se puedan pegar a la membrana. Entonces el DNA es transferido a la
membrana por el tampón absorbido por las servilletas. El siguiente paso consiste en
separar la membrana e incubarla con una sonda de cadena sencilla marcada
radioactivamente que sea complementaria a la secuencia diana. Se lava la sonda que no
se haya unido y se expone una película de rayos X a la membrana. Como la sonda
radioactiva ha hibridado sólo con sus fragmentos de restricción complementarios, la
película quedará expuesta solamente en las bandas correspondientes a estos fragmentos.
La comparación de estas bandas con marcadores de tamaño radioactivos muestra el
número y tamaño de los fragmentos en que se encuentra la secuencia diana. Este
procedimiento se denomina transferencia de Southern cuando lo que se transfiere a la
membrana es DNA, y transferencia de Northern cuando es RNA. [Según J. D. Watson,
M. Gilman, J. Witkowski y M. Zoller, Recombinant DNA, 2ª edición. Copyright 1992
de Scientific American Books.)
Figura 20-13 Paseo cromosómico
Este paseo cromosómico empieza con un fago recombinante obtenido a partir de una
genoteca construida mediante digestión parcial con EcoRI de un genoma eucariótico. El
76
fago recombinante se utiliza entonces para aislar otro fago recombinante que contenga
un segmento adyacente de DNA eucariótico. Este paseo ilustra cómo empezar en el
marcador molecular A y llegar al gen diana D. [Según J. D. Watson, J. Tooze y D. T.
Kurtz, Recombinant DNA: A Short Course. Copyright 1983 de W. H. Freeman and
Company).
Figura 20-14 Reacción en cadena de la polimerasa
La reacción en cadena de la polimerasa copia rápidamente una secuencia de DNA diana.
(a) DNA de doble cadena que contiene la secuencia diana. (b) Los dos cebadores
escogidos o diseñados poseen secuencias complementarias a los extremos 3’ de la
secuencia que se desea amplificar en ambas cadenas de DNA. Las cadenas se separan al
calentarse, permitiendo que los cebadores se unan a sus secuencias complementarias.
Los dos cebadores flanquean la secuencia diana. (c) La Taq polimerasa sintetiza las
primeras cadenas complementarias de la reacción. Estas dos primeras cadenas tienen un
tamaño variable, debido a que carecen de una señal de terminación común, y se
extienden más allá de la secuencia diana delimitada por los cebadores. (d) Las dos
moléculas de doble cadena se desnaturalizan de nuevo, exponiendo cuatro sitios de
unión de los cebadores. Los dos cebadores vuelven a unirse a sus respectivas secuencias
complementarias en los extremos 3’ de la región diana. (e) La Taq polimerasa sintetiza
cuatro cadenas complementarias. Aunque las cadenas molde en este paso son de
longitud variable, dos de las cuatro cadenas que se sintetizan a partir de ellas ya tienen
exactamente la longitud de la secuencia diana deseada. Esta longitud precisa se debe a
que cada cadena nueva comienza donde se une el cebador, en un extremo de la
secuencia diana, y avanza hasta alcanzar el final del molde, en el otro extremo de la
secuencia. (f) El proceso puede repetirse indefinidamente, produciendo cada vez más
77
moléculas de DNA de doble cadena idénticas a la secuencia diana. [Según J. D. Watson,
M. Gilman, J. Witkowski y M. Zoller, Recombinant DNA, 2ª edición. Copyright 1992
de Scientific American Books.)
Figura 20-15 Estructura de los 2’, 3’-didesoxinucleótidos
Los 2’, 3’-didesoxinucleótidos, que se utilizan en el método de secuenciación
desarrollado por Sanger, carecen del grupo hidroxilo de la ribosa presente en el DNA.
Figura 20-16 El método de secuenciación con didesoxinucleótidos
El DNA se puede secuenciar eficazmente mediante la inclusión de didesoxinucleótidos
entre los nucleótidos usados para copiar un segmento de DNA. (a) Para iniciar la
síntesis, se utiliza un cebador marcado (correspondiente a una secuencia del vector
adyacente al inserto). La adición de cuatro didesoxinucleótidos diferentes (en este caso,
se muestra el ddATP) detiene la síntesis aleatoriamente. (b) Los fragmentos resultantes
se separan por electroforesis y se someten a autorradiografía. A la derecha se muestra la
secuencia inferida. (c) Gel de secuenciación por el método de Sanger. [(a y b) De J. D.
Watson, M. Gilman, J. Witkowski y M. Zoller, Recombinant DNA, 2ª edición.
Copyright 1992 de Scientific American Books. (c) De Loida Escote-Carlson.]
Figura 20-17 Lectura de una secuencia de DNA obtenida con un secuenciador
automático
Copia impresa del cromatograma obtenido con un secuenciador automático que utiliza
compuestos fluorescentes. Cada uno de los cuatro colores representa una base diferente.
La letra “N” representa una base que no puede ser asignada porque los picos son
demasiado bajos. Nótese que, si esto fuera un gel como en la Figura 20-16c, cada uno
78
de estos picos correspondería a una de las bandas oscuras en el gel; en otras palabras,
estos picos coloreados representan una lectura diferente de la misma clase de datos que
los producidos en un gel de secuenciación.
Figura 20-18 Salto y paseo cromosómico
Manipulación de los fragmentos genómicos clonados para hacer un salto cromosómico,
un tipo modificado de paseo cromosómico que puede evitar regiones difíciles de clonar.
(a) Después de clonar todos los fragmentos y construir una genoteca, una sonda del
principio de la región de DNA investigada (en amarillo) es utilizada para rastrear los
clones y encontrar el que contiene la secuencia inicial. Cuando se encuentra este clon, se
escinde el otro extremo de la secuencia de empalme (en lila) y se utiliza para rastrear la
genoteca de nuevo y hacer un segundo salto. (b) A partir de cada nueva posición
obtenida en los saltos, se pueden hacer paseos cromosómicos en ambas direcciones para
ordenar un segundo conjunto de fragmentos clonados más pequeños.
Figura 20-19 Principales diferencias morfológicas entre el teosinte salvaje y el maíz
domesticado
La gramínea salvaje teosinte tiene relativamente pocos granos y todos rodeados por
cubiertas duras, mientras que el maíz domesticado tiene muchos más granos y todos
expuestos. [Cortesía de Nicolle Roger Fuller, National Science Foundation.]
Figura 20-20 Resultado de insertar un gen del maíz en el teosinte
Una espiga de teosinte con los granos típicos (izquierda) se muestra al lado de una
espiga de teosinte con el alelo tga1 del maíz introgresado (maize:tga1). Fíjese en los
79
granos expuestos (derecha). [Cortesía de J. F. Doebley, Departamento de Genética,
Universidad de Wisconsin-Madison.]
Figura 20-21 Amniocentesis
En la amniocentesis, se analizan células obtenidas del líquido amniótico para detectar
alelos defectivos en homocigosis.
Figura 20-22 Métodos para introducir un transgén
Algunos de los diferentes métodos para introducir DNA foráneo en una célula.
Figura 20-23 Dos resultados de la transformación con vectores simples de levadura
Un plásmido portador de un alelo funcional (gen X+) se inserta en una cepa receptora de
levadura con un gen defectivo (X–) mediante recombinación homóloga. El resultado
puede ser la sustitución del gen defectivo X– (arriba) o su retención conjuntamente con
el nuevo alelo. El sitio mutante del gen X– está representado como una barra vertical
negra. Aunque no se muestra, también pueden producirse entrecruzamientos sencillos
en la posición 2.
Figura 20-24 Infección por el plásmido Ti
Para causar la enfermedad de la agalla de la corona, la bacteria A. tumefaciens inserta
una parte de su plásmido Ti, una región denominada T-DNA, en un cromosoma de la
planta hospedadora.
Figura 20-25 El plásmido Ti de Agrobacterium tumefaciens
80
Representación simplificada de las regiones principales del plásmido Ti de A.
tumefaciens. El T-DNA, cuando se inserta en el DNA cromosómico de la planta
hospedadora, dirige la síntesis de nopalina, que la bacteria utiliza luego para sus propios
fines. El T-DNA también provoca la división incontrolada de la célula vegetal, lo que da
lugar a la formación de un tumor.
Figura 20-26 Generación de una planta transgénica
Una planta transgénica es generada a través del crecimiento de una célula transformada
mediante T-DNA.
Figura 20-27 Patrón de transmisión del T-DNA
La región del T-DNA y cualquier DNA que contenga, una vez insertados en un
cromosoma de una planta transgénica se transmiten con un patrón de herencia
mendeliano.
Figura 20-28 Creación de transgenes en Caenorhabditis elegans
Los transgenes de C. elegans son creados mediante la inyección de DNA transgénico
directamente en una gónada. (a) Método de inyección. (b) Los dos principales tipos de
resultados de la transgenia: grupos de transgenes extracromosómicos y grupos
integrados en posiciones cromosómicas ectópicas.
Figura 20-29 Creación de transgenes en Drosophila melanogaster
Los transgenes en D. melanogaster se crean inyectando un vector transponible en un
embrión de Drosophila en las primeras fases de su desarrollo. (a) Estructura global de
elementos transponibles P autónomos y no autónomos. (b) Método de inyección. (c) El
81
vector circular del elemento P (arriba) y una integración en una posición cromosómica
ectópica (abajo). Nótese que las secuencias bacterianas del vector no se integran en el
genoma, sino que en la integración, exactamente una única copia del segmento de DNA
queda contenida entre los extremos del elemento P.
Figura 20-30 Creación de transgenes en Mus musculus
Los transgenes son creados en M. musculus por inserción en posiciones cromosómicas
ectópicas. (a) Método de inyección. (b) Inserción ectópica típica, con múltiples copias
del transgén recombinante insertadas formando un grupo.
Figura 20-31 Producción de células que contienen un gen específico noqueado
Producción de células que contienen una mutación en un gen específico, también
conocida como mutación dirigida o noqueado. (a) Las copias de un gen clonado son
alteradas in vitro para obtener un vector dirigido. El gen que se muestra se ha inactivado
mediante la inserción del gen de resistencia a la neomicina (neoR) en la región
codificadora del gen (exón 2), y esta construcción se ha insertado en un vector. El gen
neoR será utilizado posteriormente como marcador para detectar la integración del
vector en un cromosoma. El vector contiene un marcador adicional en un extremo, el
gen tk de herpes. Estos marcadores son los habituales, pero podrían utilizarse otros en
su lugar. El vector completo, con sus dos marcadores, se introduce en células aisladas a
partir de un embrión de ratón. (b) Cuando se produce recombinación homóloga
(izquierda), las regiones homólogas del vector, junto con cualquier DNA que haya entre
ellas pero excluyendo el marcador del extremo, pasan a ocupar el lugar del gen original.
Este hecho es importante porque las secuencias del vector constituirán una marca muy
útil para detectar la presencia de este gen mutante. En muchas células, sin embargo, el
82
vector completo (incluyendo el marcador del extremo) se inserta ectópicamente (centro)
o ni tan solo se integra (abajo). (c) Para aislar células portadoras de la mutación
deseada, se cultivan las células en un medio con los compuestos químicos apropiados,
en este caso, un análogo de la neomicina (G148), y el ganciclovir. El compuesto G148
es letal para las células que no contengan un gen neoR funcional, y de este modo se
eliminan las células en las que el vector no se ha integrado (en amarillo). A su vez, el
ganciclovir es tóxico para las células portadoras del gen tk, con lo que se eliminan las
células en las que el vector se ha integrado aleatoriamente (en rojo). Por consiguiente,
prácticamente las únicas células que sobreviven y proliferan son aquellas en las que se
ha producido la integración homóloga (en verde). (Según M. R. Capecchi, Targeted
Gene Replacement. Copyright 1994 de Scientific American, Inc. Reservados todos los
derechos.)
Figura 20-32 Producción de un ratón con un gen específico noqueado
Un ratón noqueado se produce mediante la inserción de células ES portadoras de la
mutación dirigida. (a) Se aíslan células madre embrionarias (ES) a partir de una línea
(A/A) de ratones agouti (marrón) y se les introduce una mutación dirigida (m) en un
cromosoma. Las células ES alteradas se introducen en embriones jóvenes como el que
se muestra en la figura. El color del pelaje de los recién nacidos permite determinar si
las células ES trasplantadas sobrevivieron en el embrión. Las células ES son
normalmente implantadas en embriones que, en ausencia de las células ES, tendrían un
pelaje totalmente negro. Estos embriones se obtienen de una línea de pelaje negro que
carece del alelo agouti dominante (a/a). Los embriones portadores de las células ES se
desarrollan en madres adoptivas. El pelaje con parches de color negro y agouti indica en
cuáles de los recién nacidos han sobrevivido y proliferado las células ES. (Estos ratones
83
se denominan quimeras porque contienen células derivadas de dos líneas diferentes de
ratones.) El color totalmente negro, sin embargo, indica que las células ES se han
perdido y estos ratones son descartados. A simboliza agouti; a negro; m es la mutación
dirigida y M el alelo salvaje correspondiente. (b) Los machos quiméricos se cruzan con
hembras negras (no agouti). Se analiza la descendencia para detectar la mutación
introducida (verde, en el círculo) en el gen de interés. El examen directo de estos genes
en los ratones agouti permite determinar cuáles de éstos heredaron la mutación
(recuadro). Se cruzan machos y hembras portadores de la mutación para dar lugar a
ratones cuyas células lleven la mutación introducida en ambas copias del gen (círculo) y
que por tanto carecen de un gen funcional. Estos animales (recuadro) son identificados
inequívocamente mediante un análisis directo de su DNA. En esto caso, el noqueo
resulta en un fenotipo de cola enrollada. (Según M. R. Capecchi, Targeted Gene
Replacement. Copyright 1994 de Scientific American, Inc. Reservados todos los
derechos).
Figura 20-33 Terapia génica en ratones
Producción de un ratón portador de un transgén terapéutico para corregir una deficiencia
de hormona del crecimiento. (a) El gen de la hormona del crecimiento de la rata (RGH),
bajo el control de una región promotora de ratón que responde a la presencia de metales
pesados, se inserta en un plásmido y se utiliza para producir un ratón transgénico. RGH
compensa el enanismo inherente (lit/lit) del ratón y se hereda con un patrón de herencia
mendeliana dominante en el pedigrí resultante. (b) Ratón transgénico. Los ratones son
hermanos, pero el de la izquierda deriva de un cigoto al que se inyectó una construcción
con el promotor de la metalotioneína fusionado al gen de la hormona del crecimiento de
la rata. (Este ratón pesa 44 g, mientras que su hermano no tratado pesa 29 g.) El nuevo
84
gen se transmite a la descendencia de modo mendeliano, lo que demuestra que se ha
integrado en un cromosoma. [De R. L. Brinster.]
Figura 20-34 Tipos de terapia génica en mamíferos
La terapia en la línea germinal introduce un transgén tanto en la línea germinal como en
las células somáticas, y por tanto puede ser heredado. La terapia génica somática
introduce el transgén sólo en algunas células somáticas.
85
PARCHEADOS
Figura 20-2 Formación de una molécula de DNA recombinante
1. Corte con EcoRI
2. Corte con EcoRI
3. Hibridación
4. Molécula de DNA recombinante
Figura 20-3 Inserción de un gen dentro de un plásmido de DNA recombinante
1. Plásmido
2. Vector
3. Sitio de corte
4. Corte con endonucleasa EcoRI
5. DNA donante
6. Sitios de corte
7. Corte con endonucleasa EcoRI
8. Hibridación
9. DNA ligasa
10. Plásmido recombinante
Figura 20-4 Cómo funciona la amplificación
1. Dianas de restricción
2. DNA donante
3. Fragmentos de restricción
4. Vector recombinante con inserto 1 ó 2
86
5. Genoma bacteriano
6. Transformación
7. Replicación, amplificación y división celular
8. Clon del fragmento donante 1
9. Clon del fragmento donante 2
Figura 20-5 Un vector plasmídico, pUC18
1. Vector pUC18
2. Sitio de clonación múltiple
3. Promotor lac
4. Corte del DNA foráneo y del vector con XbaII.
5. Transformación de las bacterias.
6. Siembra en una placa con ampicilina y X-Gal.
7. Azul
8. Blanco
9. Sin inserto
10. Inserto
11. Inserto
Error: sobra la palabra “Insert” sola situada más a la izquierda en la parte inferior de la
figura.
Figura 20-6 Clonación en el fago λ
1. DNA genómico
2. Dianas Sau3A
3. Digestión parcial con Sau3A (compatible con BamHI)
87
4. Aislamiento de los fragmentos de 15 kb.
5. Se descartan los fragmentos mayores o menores.
6. Vector bacteriófago λ
7. Digestión con BamHI.
8. Aislamiento de los brazos izquierdo y derecho.
9. Ligación.
10. Brazo izquierdo
11. Brazo derecho
12. Unidades de DNA recombinante en tándem
13. DNA genómico 15 kb
14. Unidades empaquetadas in vitro dentro de los fagos
15. Genoteca de DNA genómico
16. Infección de E. coli.
17. Calvas
18. Rastreo de la genoteca con una sonda de ácidos nucleicos.
Figura 20-7 Estructura de un vector BAC
1. Promotor T7
2. Promotor SP6
Figura 20-8 Métodos para introducir el DNA recombinante dentro de células
bacterianas
1. Transformación
2. Transducción
3. Infección
88
4. Lisis
5. Fagos descendientes
Figura 20-9 Búsqueda del clon de interés mediante el uso de sondas de DNA o
RNA
1. Genoteca de clones de fago
2. Cultivo confluente de bacterias
3. Calva creada por un clon del fago
4. Transferencia de las calvas a una membrana absorbente.
5. Incubación de la membrana con una sonda radioactiva.
6. Membrana
7. Autorradiografía para localizar el clon deseado.
8. Película
9. Clon deseado
10. Infección de un nuevo hospedador bacteriano.
11. Amplificación del gen deseado.
Figura 20-10 Búsqueda del clon de interés mediante el uso de anticuerpos
1. Digestión con EcoRI
2. Promotor lac
3. β-galactosidasa
4. Extremo cohesivo EcoRI
5. Ligación.
6. Proteína de fusión
7. Empaquetamiento in vitro. Siembra sobre un cultivo confluente.
89
8. Colocación de la membrana sobre la placa.
9. Separación de la membrana.
10. Placa original
11. Las proteínas se unen a la membrana.
12. Incubación de la membrana con un anticuerpo primario. Lavado de la membrana.
Incubación
de
la
membrana
con
un
anticuerpo
secundario
marcado
radioactivamente.
13. Proteína de fusión unida a la membrana
14. Anticuerpo secundario marcado
15. Anticuerpo primario
16. El anticuerpo identifica algunas calvas específicas.
17. Autorradiografía
18. Película de rayos X
Figura 20-11 Electroforesis en gel
1. Clones
2. Dirección de migración
Figura 20-12 Búsqueda de ácidos nucleicos específicos mediante el uso de
electroforesis en gel y transferencia
1. RNA o DNA
2. Marcador de tamaños marcado con 32P
3. Electroforesis
4. Migración
5. Servilletas de papel
90
6. La solución absorbida por las servilletas de papel pasa a través del gel y la
membrana
7. Esponja
8. Membrana
9. Solución salina
10. Gel
11. Gel
12. Membrana
13. DNA transferido a la membrana
14. Hibridación con una sonda de ácidos nucleicos.
15. Membrana en una bolsa sellada.
16. Eliminación de la sonda que no se ha unido.
17. Sonda hibridada a las secuencias complementarias
18. Exposición de una película de rayos X a la membrana.
19. Autorradiografía
Figura 20-13 Paseo cromosómico
1. DNA eucariótico
2. Corte con EcoRI; inserción entre los brazos de λ.
3. Brazos de λ
4. Rastreo con una sonda del gen A.
5. Genoteca de λ
6. Clon λ 1
7. Amplificación de un pequeño fragmento mediante clonación.
8. Nuevo rastreo de la genoteca.
91
9. Clon adyacente λ 2
10. Amplificación de un pequeño fragmento mediante clonación, etc.
11. Clones λ que solapan generados por digestión parcial
Figura 20-14 Reacción en cadena de la polimerasa
1. Región en el DNA diana que se quiere amplificar
2. 1 Calentamiento para separar las dos cadenas.
3. 2 Adición de cebadores sintéticos; enfriamiento.
4. 3 Adición de DNA polimerasa tolerante al calor para catalizar la reacción de síntesis
del DNA 5’ → 3’.
5. Repetición de los pasos 1 y 2.
6. Síntesis de DNA (paso 3) catalizada por la DNA polimerasa tolerante al calor.
7. Repetición de los pasos del 1 al 3.
8. Después de 25 ciclos, la secuencia diana ha sido amplificada unas 106 veces.
Figura 20-15 Estructura de los 2’, 3’-didesoxinucleótidos
1. base
2. No se puede formar un enlace fosfodiéster con el siguiente dNTP
Figura 20-16 El método de secuenciación con didesoxinucleótidos
1. Cadena de DNA
2. Cebador marcado
3. DNA polimerasa I + 4 dNTPs + ddATP
4. Cebador marcado
5. DNA polimerasa I + 4 dNTPs +
92
6. Gel de acrilamida
7. Secuencia inferida a partir del gel
8. Secuencia de DNA de la cadena original
Figura 20-18 Salto y paseo cromosómico
1. (a) Salto cromosómico
2. 1 Corte del DNA de la región que contiene el gen de interés en fragmentos grandes.
3. Fragmento de DNA
4. Punto de inicio
5. 2 Circularización del fragmento.
6. Corte
7. Corte
8. 3 Cortar la región de empalme y 4 clonarla utilizando un fago como vector.
9. Fragmento de empalme
10. Usar como punto de inicio para el segundo salto.
11. (b) Paseo cromosómico a partir de cada punto obtenido en los saltos
12. Inicio
13. Gen de interés
14. Paseos bidireccionales
Figura 20-19 Principales diferencias morfológicas entre el teosinte salvaje y el maíz
domesticado
1. Teosinte
2. Maíz moderno
93
Figura 20-21 Amniocentesis
1. Recogida de una muestra de líquido
2. Centrifugación.
3. Placenta
4. Cavidad amniótica
5. Pared uterina
6. Fracción líquida
7. Células
8. Estudios bioquímicos y enzimáticos
9. Cultivo celular
10. Estudios bioquímicos y cromosómicos (cariotipo)
Figura 20-22 Métodos para introducir un transgén
1. Disparador de partículas
2. Tungsteno recubierto de DNA
3. Inyección
4. Transformación
5. Virus
6. Transgén
Figura 20-23 Dos resultados de la transformación con vectores simples de levadura
1. Gen X1
2. Doble entrecruzamiento en 1 y 2
3. Plásmido
4. Marcador
94
5. Gen X1
6. Núcleo
7. Cromosoma
8. Gen X2
9. Entrecruzamiento sencillo en 1
10. Gen X1
11. Marcador
12. Gen X2
Figura 20-24 Infección por el plásmido Ti
1. Plásmido Ti
2. Genoma bacteriano
3. DNA cromosómico de la planta
4. Célula vegetal transformada
5. Agalla de la corona
Figura 20-25 El plásmido Ti de Agrobacterium tumefaciens
1. Producción del tumor
2. Síntesis de nopalina
3. Utilización de la nopalina
4. Origen de replicación
5. Funciones de transferencia del T-DNA
6. Plásmido Ti
Figura 20-26 Generación de una planta transgénica
95
1. Plásmido Ti cointegrado
2. Célula de planta de tabaco
3. Célula transformada
4. Cultivo celular
5. Plántula
6. Planta de tabaco transgénica
7. Célula de una planta transgénica
Figura 20-27 Patrón de transmisión del T-DNA
1. Par cromosómico en una planta transgénica
2. Límites del T-DNA
3. Segmento de interés
4. Autopolinización
5. Descendencia
Figura 20-28 Creación de transgenes en Caenorhabditis elegans
1. Región sincitial
2. Gónada
3. Núcleos
4. Micropipeta con una solución de DNA
5. Huevo
6. Unidad del DNA recombinante inyectado
7. Agrupación de transgenes extracromosómico
8. Agrupación de transgenes integrado
9. Cromosoma
96
Figura 20-29 Creación de transgenes en Drosophila melanogaster
1. (a) Elementos P
2. Gen de la transposasa
3. Autónomo
4. Extremo del elemento P
5. Extremo del elemento P
6. No autónomo
7. Deleción de la mayor parte del gen de la transposasa
8. (b) Método de inyección
9. Micropipeta con una solución de DNA
10. Núcleos
11. Anterior
12. Posterior
13. Embrión de Drosophila
14. Posición final de las células germinales
15. (c) Integración
16. Vector bacteriano
17. Cromosoma
18. Inserción
19. Segmento de DNA de interés
Figura 20-30 Creación de transgenes en Mus musculus
1. Núcleo
2. Micropipeta con solución de DNA
97
3. Embrión de ratón de una sola célula
4. Cromosoma
5. Transgenes integrados
Figura 20-31 Producción de células que contienen un gen específico noqueado
1. (a) Producción de células madre embrionarias con un gen noqueado
2. Gen clonado
3. Exón 2
4. Exón 1
5. Adición del gen tk+.
6. Inserción de neoR dentro del exón 2.
7. Vector dirigido
8. Adición del vector dirigido.
9. Cultivo de células madre embrionarias de ratón
10. (b) Inserción dirigida del vector mediante recombinación homóloga
11. Resultados posibles
12. Gen diana en el cromosoma
13. Cromosoma con la inserción dirigida
14. Inserción ectópica (aleatoria)
15. Gen de cualquier cromosoma
16. Cromosoma con una inserción aleatoria
17. No se produce inserción
18. Gen de cualquier cromosoma
19. Cromosoma inalterado
20. (c) Selección de las células portadoras del gen noqueado
98
21. Análogo de la neomicina
22. Mata a las células neoS
23. Ganciclovir
24. Mata a las células tk+
25. Adición al medio.
26. Célula sin inserción
27. Célula con la inserción dirigida
28. Célula con una inserción aleatoria
29. Células portadoras de la mutación dirigida
Figura 20-32 Producción de un ratón con un gen específico noqueado
1. Mutación dirigida
2. Cromosoma normal
3. Células ES de un ratón marrón
4. Ratón marrón
5. Hembra negra
6. Embrión en estado de blastocisto
7. a/a; M/M más A/A; M/m Embrión alterado
8. Embrión
9. Madre adoptiva
10. Macho quimérico recién nacido (portador de células originarias de dos líneas de
ratones)
11. a/a; M/M más A/A; M/m
12. Adulto quimérico
99
Error: Figura incompleta. En la última columna de la parte (b) de la figura, falta el
dibujo de un ratón en la parte superior, sobre los tres que hay. Debería ser un ratón
NEGRO y con la COLA ENROLLADA, representado sobre un fondo verde y con un
círculo en el lado superior derecho (al igual que el primer ratón de esta columna, aunque
este es marrón y no negro). Debajo del dibujo debería aparecer la leyenda a/a; m/m. En
la edición anterior hay un ratón dibujado en este lugar pero no tiene la cola enrollada ni
está etiquetado como aa mm, que es el resultado del cruzamiento que falta.
Figura 20-33 Terapia génica en ratones
1. Plásmido
2. Promotor de la metalotioneína de ratón (MP)
3. Gen de la hormona del crecimiento de rata (RGH)
4. Cigoto lit/lit
5. Madre adoptiva
6. Hijo transgénico
7. Pesos relativos
8. Ratones grandes
9. Ratones enanos lit/lit
10. Interpretación
11. Transgénico y grande
12. Enano
13. Grande
14. Enano
Figura 20-34 Tipos de terapia génica en mamíferos
100
1. (a) Terapia génica en la línea germinal
2. Célula transgénica
3. Fase de blastocisto
4. Soma en mosaico
5. Gónada en mosaico
6. (b) Terapia génica somática
7. Transgén
8. Clones transgénicos
Figura Problema 17
1. Niño 1
2. Transferencia de Southern
3. Digestión de DNA genómico con Xho
4. Sonda: gen D marcado con
32
P; Autorradiografías de transferencias de Northern
(muestras de diferentes etapas del desarrollo)
5. Edad:
6. 1 año 2 años 3 años 4 años
7. Intensidad de las bandas escaneadas:
8. Muestras de enzima
9. Tinción de la enzima activa
10. Edad:
11. 1 año 2 años 3 años 4 años
12. Unidades de enzima activa:
13. Niño 2
14. Transferencia de Southern
101
15. Digestión de DNA genómico con Xho
16. Transferencias de Northern
17. Edad:
18. 1 año 2 años 3 años 4 años
19. Intensidad de las bandas escaneadas:
20. Muestras de enzima
21. Tinción de la enzima activa
22. Edad:
23. 1 año 2 años 3 años 4 años
24. Unidades de enzima activa:
102
TABLAS
Tabla 20-1 Algunas enfermedades genéticas comunes
Errores innatos del metabolismo
Incidencia aproximada entre los nacidos
vivos
1. Fibrosis quística (proteína de un canal
1/1600 caucasianos
de cloro defectiva)
2. Distrofia muscular de Duchenne
1/3000 chicos (ligada al X)
(proteína muscular defectiva)
3. Enfermedad de Gaucher
1/2500 judíos Ashkenazi; 1/75000 otros
(glucocerebrosidasa defectiva)
4. Enfermedad de Tay-Sachs
1/3500 judíos Ashkenazi; 1/35000 otros
(hexosaminidasa A defectiva)
5. Pentosuria esencial (condición
1/2000 judíos Ashkenazi; 1/50000 otros
benigna)
6. Hemofília clásica (factor de
1/10000 chicos (ligada al X)
coagulación VIII defectivo)
7. Fenilcetonuria (fenilalanina
1/5000 irlandeses celtas; 1/15000 otros
hidroxidasa defectiva)
8. Cistinuria (transportador de membrana
1/15000
de la cisteína defectivo)
9. Leucodistrofia metacromática
1/40000
(arilsulfatasa A defectiva)
10. Galactosemia (galactosa-1-fosfato
1/40000
uridil transferasa defectiva)
103
11. Anemia falciforme (cadena de la β-
1/400 negros en Estados Unidos
globina defectiva). En algunas
poblaciones de África Occidental, la
frecuencia de heterocigotos es del 40%
12. Talasemia (cadena de la globina
1/400 en algunas poblaciones
reducida o ausente)
mediterráneas
Nota: Aunque una inmensa mayoría de las más de 500 enfermedades genéticas
recesivas reconocidas son extremadamente raras, en conjunto constituyen una carga
enorme de sufrimiento humano. En consistencia con las mutaciones mendelianas, la
incidencia de algunas de estas enfermedades es mucho más alta en ciertos grupos
raciales que en otros.
Fuente: J. D. Watson, M. Gilman, J. Witkowski y M. Zoller, Recombinant DNA, 2ª
edición. Copyright 1992 de Scientific American Books.
104
Descargar

TEXTO - ¿Cómo se puede aislar y amplificar un gen... - ¿Cómo se pueden identificar DNAs o RNAs específicos...

EXAMEN DE BIOLOGÍA MOLECUL4R GRUPO A JUNIO−99

EXAMEN DE BIOLOGÍA MOLECUL4R GRUPO A JUNIO−99

Proceso de replicaciónFarmaciaTraducción en ProcariotasReplicación de los genesProblema TeloméricoDNA PolimerasaRNA Polimerasa

Los ácidos nucleicos

Los ácidos nucleicos

Ácido fosfóricoTeoría de las proteínasMecanismos molecularesSoporte molecularEstructura química de los genesNucleótidosPolímerosDNA (Deoxyribonucleic Acid)Biología celularInformación genética

Material genético

Material genético

ADN (Ácido Desoxirribonucleico)CromosomaCélulaEstructuraOrganización

Papilomavirus

Papilomavirus

ADN (Ácido Desoxirribonucleico)VirusEnfermedades víricasTratamientoVPHPropiedadesPrevención

Sistema glandular interno

Sistema glandular interno

MitosisCitologíaOsmosisReproducción asexualHormonasCélulasEstructura genética