Instituto Inmaculada Concepción Valdivia
Departamento de Ciencia y tecnología
Biología
Guía de Ejercicios Biología IV Medio
Objetivos
Capacidad: Razonamiento lógico, Analizar, Expresión Escrita
Destrezas: Expresar, Identificar, Interpretar, Determinar
Valor: Fe
Actitud: Alegría
Trabajo con Alegría
Desarrolla las siguientes estrategias
1. Expresar
en forma breve y precisa, el proceso
que representa la imagen adjunta,
utilizando vocabulario adecuado al subsector de biología, trabajando con alegría.
2. Identificar la hebra complementaria del siguiente fragmento de DNA y el RNAm que se
obtiene a partir de ella completando dichas secuencias
ACTCGCGTAAATCAGCCGCGGTA
ADN COMPLEMENTARIO:
ARN MENSAJERO
:
3.- Identificar los conceptos que completan las siguientes textos referidos a la transcripción.
5'-3' - Elongación Terminación promotor
Iniciación - Maduración
exones -
intrones -
RNA-ligasa
poli-A -
RNA-polimerasa
poli-A
polimerasa -
- ribonucleoproteína pequeña nuclear
La transcripción se lleva en las siguientes etapas:
1.-…………………………… : La……………………………… se une a una zona del DNA previa al DNA que se quiere
transcribir llamada………………………… ; a continuación se corta la hebra de DNA y se separan las dos
cadenas, iniciándose el proceso de copia del DNA a transcribir; esta copia no requiere ningún
cebador; los ribonucleótidos se añaden en sentido…………………………………….. .
2.-…………………………………… : La RNA-polimerasa continúa añadiendo ribonucleótidos complementarios
al DNA hasta que se llega a una determinada secuencia que indica a la polimerasa el final de la
zona a transcribir.
3.-………………………………………. : La transcripción finaliza, y al RNA recién formado se le añade una
cola de unos 200 nucleótidos de adenina, la cola de………………………………. , añadida por la
enzima…………………………………… , que sirve para que el RNA no sea destruido por las nucleasas
celulares.
4.-………………………………… de los productos de la trancripción: Se da en el núcleo de eucariotas y la
realiza la enzima……………………………………….
(RNPpn) eliminando los……………………………
del RNA,
quedando los…………………………………. libres para ser unidos por una .
3.- Identificar cuales de los siguientes elementos participan en la transcripción del DNA y
señalar su función trabajando con la alegría del que aprende.
Transcripción DNA
Nucleótidos trifosfato
Una molécula de DNA
DNA-polimerasa
RNA-ligasa
Helicasas
Poli-A polimerasa
Desoxirribonucleótidos
Ribonucleótidos
RNA-transferentes
RNA-ribosómicos
Ribonucleoproteína
pequeña nuclear
RNA-polimerasa
4.-
Interpretar
la
imagen
adjunta
señalando:
A. Lo que representa
B. Cuál es el significado de la información
que proporciona.
5. Analizar las imágenes que ilustran el proceso de transcripción respondiendo las siguientes
preguntas en el espacio en blanco.
A.
A.
¿Qué sentido tiene la hebra de templado?
B. ¿Cuál es la función de la RNA polimerasa?
C. ¿Cuál es el sentido del transcripto?
D. Cuál es la función del sitio activo?
E .¿De qué manera se relaciona la ADN polimerasa
con la ARN polimerasa?
B: A¿Cuál es la secuencia de inicio y cuál de término?
C. ¿Qué función realiza la enzima girasa?
d..¿Qué estructuras participan en este proceso de transcripción?
6.-A Determinar qué tipo de proceso se muestran en las imágenes y el tipo de célula en la cual se
realiza fundamentando la respuesta.
B. Determinar lo que representan cada uno de los números y letras
7. Interpretar tabla de datos experimentales para resolver el siguiente problema
Se obtiene una muestra de DNA, se transcribe a mRNA y se purifica. Se separan
entonces las dos hebras del DNA y se analiza la composición de bases de cada hebra del
DNA y del mRNA. Se obtienen los datos recogidos en la tabla de la derecha. ¿¿Qué hebra
del DNA es la hebra transcrita, que sirve como molde para la síntesis del mRNA?
A
G
C
T
hebra DNA n.º 1 19.1 26.0 31.0 23.9
hebra DNA n.º 2 24.2 30.8 25.7 19.3
mRNA
19.0 25.9 30.8 0
U
0
0
24.3
8.- Determinar la respuesta al siguiente problema referido a la transcripción del DNA
La región codificadora de un gen en eucariotas está formada por cuatro exones de 99, 75, 66 y 90
nucleótidos y tres intrones, intercalados entre los exones, de 45, 63 y 42 nucleótidos,
respectivamente. Indicar: a) cuántos nucleótidos tendrá el ARNm precursor; b) cuántos nucleótidos
tendrá la región que se traducirá del ARNm maduro y c) cuántos aminoácidos tendrá el péptido
codificado.
Descargar

transcripcion del adndef - Instituto Inmaculada Concepción

Los ácidos nucleicos

Los ácidos nucleicos

Ácido fosfóricoTeoría de las proteínasMecanismos molecularesSoporte molecularEstructura química de los genesNucleótidosPolímerosDNA (Deoxyribonucleic Acid)Biología celularInformación genética

EXAMEN DE BIOLOGÍA MOLECUL4R GRUPO A JUNIO−99

EXAMEN DE BIOLOGÍA MOLECUL4R GRUPO A JUNIO−99

Proceso de replicaciónFarmaciaTraducción en ProcariotasReplicación de los genesProblema TeloméricoDNA PolimerasaRNA Polimerasa

Material genético

Material genético

ADN (Ácido Desoxirribonucleico)CromosomaCélulaEstructuraOrganización

Papilomavirus

Papilomavirus

ADN (Ácido Desoxirribonucleico)VirusEnfermedades víricasTratamientoVPHPropiedadesPrevención