TRABAJO DE BIOLOGIA II
NOMBRE: ________________________________________
CALIF:______________
1. Dada la siguiente secuencia de ADN:
5'-ATCCCTAGTATTATG-3'
Escribe la cadena complementaria:
Escribe el ARN m correspondiente a la cadena complementaria:
Escribe la cadena polipeptídica que se origina:
2. DE LAS PALABRAS DEL RECUADRO ESCOGE LA CORRECTA
ácido fosfórico
ácidos nucleicos
genética información genética
purina ribonucleico
éster biológicas
desoxirribonucleico
desoxirribosa
expresar
nucleósido
nucleótido
pentosa pirimidina
polímeros
Los
son macromoléculas
que realizan funciones de vital interés e importancia en
todos los seres vivos. Fueron descubiertos por Freidrich Miescher en 1869. Estas moléculas se encargan
de almacenar, transmitir y
la información
.
Hay 2 tipos de ácidos nucleicos (AN): el ácido
(DNA) y el ácido
(RNA), y están
presentes en todas las células. Su función biológica no quedó plenamente demostrada hasta que Avery y
sus colaboradores demostraron en 1944 que el DNA era la molécula portadora de la
Los AN son
lineales en los que la unidad repetitiva, llamada
(la ribosa o la
),
la pentosa con una base constituye un
el ácido fosfórico da lugar al nucleótido.
y una base nitrogenada (
.
, está constituída por: una
o
. La unión mediante un enlace
). La unión de
entre el nucleósido y
3. Un fragmento de la cadena de ADN que codifica la oxitocina tiene la siguiente secuencia de bases:
ADN
ARNm:
TRADUCCION:
3'TTAGCAGTATATTTGATTACACGGTAGCCCCAT5'.
4. Los tres tipos de RNA implicados en comprender el núcleo estructural y funcional para la síntesis de las
proteínas, sirviendo como modelo para la traducción y para el transporte de aminoácidos,
respectivamente, son:
A)
B)
C)
D)
E)
mRNA, tRNA, rRNA
rRNA, tRNA, mRNA
tRNA, mRNA, rRNA
tRNA, rRNA, mRNA
rRNA, mRNA ,tRNA
5. Para la hebra de DNA 5'-TACGATCATAT-3' , la hebra de DNA complementario correcta es:
A
B
C
D
E
3'-TACGATCATAT-5'
3'-ATGCTAGTATA-5'
3'-AUGCUAGUAUA-5'
3'-GCATATACGCG-5'
3'-TATACTAGCAT-5'
6. Las bases púricas son ....
a) la adenina y la timina
b) la adenina y la guanina
c) la citosina y la guanina
d) la citosina y la timina
7. La base complementaria de la citosina (C) es ...
a) timina (T);
b) adenina (A);
c) guanina (G);
d) el uracilo (U).
8. La base complementaria de la adenina (A) es ...
a) la timina (T);
b) la citosina (C);
c) la guanina (G);
d) el uracilo (U).
9. Un nucleótido es:
a) el monómero que forma las proteínas;
b) el monómero que forma los ácidos nucleicos;
c) cada una de las bases de los ácidos nucleicos;
d) la unión del monosacárido y la base nitrogenada.
10. Los componentes de un nucleótido son:
(indicar la respuesta que da el orden correcto)
a) Ácido fosfórico, azúcar, base nitrogenada;
b) Azúcar, fosfórico, base nitrogenada;
c) Azúcar, base nitrogenada, ácido fosfórico;
d) azúcar, base nitrogenada.
11. Los ácidos nucleicos son...
a) polímeros formados por la unión de nucleótidos mediante enlaces peptídicos;
b) polímeros formados por la unión de aminoácidos mediante enlaces peptídicos;
c) polímeros formados por la unión de nucleótidos mediante enlaces fosfoéster;
d) polímeros formados por la unión de nucleótidos mediante enlaces N-glicosídicos.
12. Los procesos de síntesis de ARN a partir del ADN se denominan...
a) replicación del ADN;
b) trascripción de la información genética;
c) traducción de la información genéticas.
d) Ninguna de las respuestas anteriores es correcta.
13. El proceso de síntesis de una proteína a partir de la información contenida en un ARNm se denomina...
a) replicación del ADN;
b) trascripción de la información genética;
c) traducción de la información genéticas.
d) Ninguna de las respuestas anteriores es correcta.
14. Los codones está constituidos por...
a) 3 bases o nucleótidos;
b) 2 bases;
c) 1 base.
d) Ninguna de las respuestas anteriores es correcta.
15. Todas las proteínas comienzan por...
a) Glicocola;
b) metionina;
c) una base nitrogenada.
d) Ninguna de las respuestas anteriores es correcta
Descargar

TRABAJO DE BIOLOGIA II NOMBRE: CALIF: Dada la siguiente

Estructura de los Ácidos nucleicos

Estructura de los Ácidos nucleicos

ADN (Ácido Desoxirribonucleico)Bases púricasSubunidades de nucléotidosQuímica

Los ácidos nucleicos

Los ácidos nucleicos

Ácido fosfóricoTeoría de las proteínasMecanismos molecularesSoporte molecularEstructura química de los genesNucleótidosPolímerosDNA (Deoxyribonucleic Acid)Biología celularInformación genética

Macromoléculas y proteínas

Macromoléculas y proteínas

HidrocarburosMoléculasAcidos NucleicosLípidosFunciones proteínicas

Diferencias entre ADN y ARN

Diferencias entre ADN y ARN

ADN (Ácido Desoxirribonucleico)NúcleoGenéticaCromosomasARN (Ácido ribonucleico)Cuadro comparativo

Procesos técnicos industriales

Procesos técnicos industriales

CerámicaHidrometalurgiaLixiviación bacterianaPolímeros sintéticosVidrioPirometalurgia

Polímeros: Modelos macroscópicos de nuevos materiales

Polímeros: Modelos macroscópicos de nuevos materiales

QuímicasHerman StaudingerAislantes eléctricos

POLIMEROS La necesidad humana de imitar a la naturaleza, sintetizando los... algunos   años   eran   de ...

POLIMEROS La necesidad humana de imitar a la naturaleza, sintetizando los... algunos años eran de ...

TermoplásticosPoliestirenoPolietilenoTermofijosPoliéster instauradoResinas epóxicasPoliuretanoCloruro de polivinioQuímicaPolimetilFenol-formaldehídoMelanina