Contestar cuestionario

advertisement
Maestría en Biología Experimental.
Biología Celular.
Maestría en Biología Celular (Membranas Internas)
Dra. Leticia Bucio Ortiz.
2007
1.- Funciones de Compartamentalización. Cada uno de los siguientes procesos está asociado con uno o más
organelos específicos de la célula eucariótica. En cada caso, identifica el organelo u organelos, y sugiere una
ventaja a la confinación del proceso a dicho organelo.
a)
b)
c)
d)
e)
f)
g)
h)
 oxidación de ácidos grasos de cadena larga.
Biosíntesis de colesterol.
Biosíntesis de insulina.
Biosíntesis de testosterona (hormona sexual masculina).
Degradación de organelos dañados o no necesarios.
Glucosilación de proteínas de membrana.
Hidroxilación de fenobarbital.
Selección de proteínas lisosomales de proteínas de secreción.
2.- Retículo Endoplásmico. Para cada uno de los siguientes pasos, indica sí es verdadero para el Retículo
Endoplasmático Rugoso (R), para el Ret. Endoplasm. Liso (L), para ambos (RL) o de ninguno (N).
a)
b)
c)
d)
e)
f)
g)
h)
i)
Contiene menos colesterol que la membrana plasmática.
Tiene ribosomas adheridos a su superficie externa (citosólica).
Esta implicado en la destoxificación de drogas.
Está implicado en el rompimiento de glucógeno.
Es el sitio para la biosíntesis de de proteínas de secreción.
Es el sitio para el doblamiento de proteínas enlazadas a la membrana.
Tiende a formar estructuras tubulares.
Usualmente consiste de sacos aplanados.
Visible solo por microscopia electrónica.
3.- Biosíntesis de Proteínas Integrales de Membrana. Además de su papel en la secreción celular, el R.E.
rugoso y el complejo de Golgi son también responsables de la biosíntesis de proteínas integrales de membrana.
Más específicamente, estos organelos son la fuente de glucoproteínas comúnmente encontradas en la
monocapa fosfolipídica externa de la membrana plasmática.
a) En una serie de diagramas, representa la síntesis y glucosilación de glucoproteínas de la membrana
plasmática.
b) Explica por qué los grupos carbohidratos de las glucoproteínas de membrana son siempre encontradas
en la superficie externa de la membrana plasmática.
c) Qué debes asumir acerca de las membranas biológicas para dibujar el diagrama indicado en el inciso b.
4.- Vesículas cubiertas en transporte intracelular. Para cada una de las siguientes aseveraciones, indica
para qué tipo de vesícula cubierta, es verdadera: clatrina (C), cubierta COPI (I), cubierta COPII (II). Cada
aseveración puede ser verdadera para una, varias o ninguna (N) de las vesículas cubiertas.
a) Las proteínas de cubierta que se enlazan a receptores LDL son mediadas por una proteína adaptadora
compleja.
b) La fusión de vesículas (después de la disociación de la cubierta) con la membrana del RE es facilitada
por proteínas específicas t-SNARE y Rab.
c) Tiene un papel en el transporte bidireccional entre RE y complejo de Golgi.
d) Tiene un papel en la selección de proteínas para el transporte intracelular a un destino específico.
e) Tiene un papel en el transporte de hidrolasas ácidas a los endosomas tardíos.
f) Es esencial para todo el proceso de endocitosis.
g) Es importante para el tráfico retrógrado a través del complejo de Golgi.
h) Está implicado en el movimiento de lípidos de membrana desde el TGN a la membrana plasmática.
i) El componente estructural básico de la cubierta es llamado trisquelión.
j) La cubierta de proteínas se disocia inmediatamente después de la formación de la vesícula.
k) Las proteínas de cubierta incluyen una pequeña proteína específica que lleva GTP.
1
Maestría en Biología Experimental.
Biología Celular.
Dra. Leticia Bucio Ortiz.
5.- Interpretación de datos. Cada una de las siguientes aseveraciones resume los resultados de un
experimento relacionado a exocitósis o endocitosis. En cada caso, explica la relevancia del experimento y su
resultado en nuestro entendimiento de este proceso.
a) Adición de colchicina a células de fibroblastos cultivados inhibiendo el movimiento del transporte de
vesículas.
b) Ciertas células de glándula pituitaria secretan laminina continuamente, pero secretan la hormona
adrenocorticotrópica sólo en respuesta a señales específicas.
c) Ciertas células de la glándula adrenal pueden inducir la secreción de epinefrina cuando su
concentración de calcio intracelular es experimentalmente incrementada.
d) Células que son sensibles a temperatura expresan una forma de dinamina no exhiben endocitosis
mediada por receptores después de un cambio de temperatura, aún ellas continúan ingiriendo fluido
extracelular (inicialmente se redujo le nivel y después a un nivel normal dentro de los 30-60 min.).
6.- Digestión Celular. Para cada una de las siguientes aseveraciones, indica el proceso (o procesos) específico
de digestión para el cual la aseveración es verdadera: Fagocitosis (F), Endocitosis mediada por receptor (R),
Autofágia (A), o Digestión Extracelular (E). Cada aseveración puede ser verdadera para una, varias o ninguna
(N) de estos procesos.
a)
b)
c)
d)
e)
f)
g)
h)
i)
j)
k)
Puede implicar exocitósis.
Puede implicar fusión de vesículas o vacuolas con lisosomas.
Material digerido es de origen extracelular.
Material digerido es de origen intracelular.
Esencial para la penetración del espermatozoide al huevo durante la fertilización.
Importante para ciertos procesos de desarrollo.
Implica hidrolasas ácidas.
Implica fusión de vesículas endocíticas con un endosoma temprano.
Implica fusión de lisosomas con la membrana plasmática.
Ocurre dentro de lisosomas.
Sirve como una fuente de nutrientes dentro de la célula.
7.- Propiedades de peroxisomas. Para cada una de las siguientes aseveraciones, indica si es verdadera del
todo (A), algo (S) o nada (N) de las varias clases de peroxisomas descritas y explica tu respuesta.
a)
b)
c)
d)
e)
f)
g)
h)
i)
Adquiere proteínas desde el RE y Complejo de Golgi.
Capaz de catabolizar ácidos grasos.
Contiene hidrolasas ácidas
Contiene catalasa
Contiene reacciones químicas que generan peróxido.
Contiene los genes que codifican para luciferasa.
Contiene urato oxidasa.
Es fuente de dolicol.
Está rodeado por una capa de fosfolípidos.
8.- Enfermedades Lisosomales. A pesar de una desconcertante variedad de síntomas, las enfermedades
lisosomales tienen un número de características en común. Para cada una de las siguientes aseveraciones,
indica sí tu puedes suponer la característica que es común a todas (o a la mayoría) de enfermedades
lisosomales (A), ser verdadera de una enfermedad lisosomal específica (S) o no ser verdadera de ninguna
enfermedad lisosomal (N).
a)
b)
c)
d)
e)
f)
g)
h)
Daño en metabolismo de glucolípidos causa deterioro mental.
Guía a la acumulación de productos de degradación en el lisosoma.
Guía a la acumulación de excesivas cantidades de glucógeno en el lisosoma.
Resulta de la inhabilidad para regular la síntesis de glucosaminglucanos.
Resulta de la ausencia de una hidrolasa ácida funcional.
Resulta en acumulación de lisosomas en la célula.
Los síntomas incluyen debilidad muscular y retardo mental.
Dispara la proliferación de organelos conteniendo catalasa.
2
Maestría en Biología Experimental.
Biología Celular.
Dra. Leticia Bucio Ortiz.
9.- Selección de proteínas. Rasgos estructurales específicos etiquetan proteínas para transportarlas a varios
destinos intracelulares y extracelulares. Tres ejemplos fueron descritos en esta unidad: (1) El pequeño péptido
Lis-Asp-Glu-Leu, (2) Dominios característicos hidrofóbicos atraviesan la membrana, y (3) Residuos de manosa
6-fosfato son pegados a oligosacaridos. Para cada rasgo estructural, responde las siguientes preguntas.
a) ¿En que lugar de la célula se incorpora la señal a la proteína?
b) ¿Cómo la señal asegura que la proteína llegue a su destino?
c) ¿A dónde iría la proteína sí la señal fuera removida?
10.- Silicosis y Asbestosis. La silicosis es una enfermedad debilitante de los mineros que resulta de la
ingestión de partículas de sílice (tal como arena o vidrio) por los macrófagos en el pulmón. Asbestosis es una
enfermedad similar, causada por la inhalación de fibras de asbesto. En ambos casos, las partículas o fibras son
encontradas en los lisosomas y fibroblastos que secretan colágena, son estimulados a depositar nódulos de
fibras de colágena en el pulmón, guiando a reducir la capacidad pulmonar, dañando la respiración y
eventualmente ocasionando la muerte.
a)
b)
c)
d)
¿Cómo piensas que las fibras llegan al interior de los lisosomas?
¿Qué efecto piensas que tiene la acumulación de fibras o partículas sobre los lisosomas?
¿Cómo puedes explicar la muerte de células conteniendo sílice o asbestos?
¿Qué piensas que ocurre a las partículas de sílice o fibras de asbestos cuando las células mueren?
¿Cómo puede la célula muerta continuar casi indefinidamente, aún después de la prevención de otra
exposición a polvo de sílice o fibras de asbesto?
e) Células fibroblastos cultivadas secretan colágena y producen fibras de tejido conectivo después de la
adición de material desde un cultivo de macrófagos de pulmón que han sido expuestos a partículas de
sílice. ¿Qué te dice seto acerca de depósitos de nódulos de colágena en los pulmones de pacientes
con silicosis?
11.- Fracción subcelular. La Fig. 12A-3 muestra un diagrama de dos dimensiones representando coeficientes
de sedimentación (en unidades Svedberg) y la densidad (en g/cm 3) de varios organelos, moléculas y virus. En
cada caso, el área de la forma oval, delimita e rango usual del valor S y densidad para una partícula dad. Usa la
Fig. 12A-3 y tus conocimientos de la técnica de centrifugación para responder las siguientes preguntas.
a) ¿Cuál organelo o moléculas tienen el valor de S más bajo? ¿El valor de S más alto? ¿La densidad más
baja? ¿La densidad más alta?
b) Compara la densidad de un ribosoma con la densidad de moléculas de RNA y proteínas. ¿En base a lo
que piensas acerca de los ribosomas, puedes explicar tu observación?
c) La mayoría de virus consiste de DNA o RNA enlazado a moléculas de proteína, ¿Cuál es el coeficiente
de sedimentación de una virus típico más grande que una molécula individual de DNA, RNA o proteína?
d) ¿Puede la centrifugación diferencial ser usada para separar efectivamente núcleos de mitocondrias?
¿Por qué sí o no? ¿Puede esta técnica ser usada para separar peroxisomas de mitocondrias? ¿Por
qué sí o no?
e) ¿Puede la centrifugación de equilibrio de densidad ser usada para separar efectivamente microsomas
de mitocondrias? ¿Por qué sí o no? Puede esta técnica ser usada para separar RNA de DNA? ¿Por
qué sí o no?
f) El mecanismo de un esquema de purificación por el cual tu puedas separar lisosomas, peroxisomas y
mitocondrias de otros componentes de un homogenado y entonces separar la mezcla de organelos en
tres fracciones distintas.
12.- Enzimas y organelos. La mayoría de organelos son identificados y descritos en términos de las enzimas
que contienen. Lisosomas y peroxisomas fueron descubiertos debido a las enzimas específicas que contienen
a) ¿Qué criterio aplicarías para identificar un nuevo organelo sin equivocarte, basado en el contenido de
enzimas dentro de un organelo?
b) ¿Tu criterio tendría que ser adecuado para identificar lisosomas en una preparación de mitocondrias?
Explica tu respuesta.
c) ¿Tu criterio tendría que ser adecuado para identificar peroxisomas en una preparación lisosomal?
Explica tu respuesta.
3
Maestría en Biología Experimental.
Biología Celular.
Maestría en Biología Celular (Síntesis de Proteínas y Selección)
Dra. Leticia Bucio Ortiz.
2007
1.- El código genético y dos hormonas humanas. La siguiente secuencia de una pequeña fracción de DNA
humano:
3’ AATTATACACGATGAAGCTTGTGACAGGGTTTCCAATCATTAA5’
5’ TTAATATGTGCTACTTCGAACACTGTCCCAAAGGTTAGTAATT3’
a) ¿Cuáles son las dos posibles moléculas de RNA que pueden ser transcritas desde este DNA?
b) Sólo una de estas dos moléculas de RNA pueden actualmente ser traducidas. Explica por qué.
c) La molécula de RNA que puede ser traducida es la de RNAm para la hormona vasopresina. ¿ Cual es
la aparente secuencia de aa para vasopresina? (consultar el código genético)
d) En esta forma activa, la vasopresina es un nonapéptido, con cisteína en el N-terminal. ¿Cómo puedes
explicar esto respecto a tu respuesta en la parte c?
e) Una hormona relacionada, la oxitocina, tiene la siguiente secuencia de aa.
Cis-Tir-Ile-Glu-Asp-Cis-Pro-Leu-Gli
¿Dónde y cómo puedes cambiar el DNA que codifica para vasopresina de tal forma que codifique para
oxitocina? ¿Tu respuesta sugiere una posible relación evolutiva entre los genes para vasopresina y
oxitocina?
4.- Comparación entre síntesis de proteínas en Procariontes y Eucariontes. Para cada uno de los
siguientes puntos, indica sí se aplica a la síntesis de proteínas en procariontes (P), en eucarionetes (E), en
ambos (B) o en ninguno (N).
a)
b)
c)
d)
e)
f)
g)
El RNAm tiene un sitio de enlace dentro del ribosoma en su región inicial.
AUG es el codón de iniciación.
La enzima que cataliza la formación del enlace peptídico es una molécula de RNA.
El RNAm es traducido en la dirección 3’ 5’.
El carbono terminal del polipéptido es sintetizado al final.
La traducción es finalizada por una molécula de RNAt especial que reconoce codones de término.
La función de la hidrólisis de GTP para inducir cambios conformacionales en varias proteínas implica la
elongación del polipéptido.
h) La hidrólisis de ATP es requerida para pegar un aa a una molécula de RNAt.
i) La especificidad requerida para unir un aa correcto a la molécula de RNAt correcta es una propiedad de
la enzima llamada aminoacil-RNAt sintetasa.
4
Descargar