Trabajo práctico: código genético y síntesis de proteínas
¿A qué nos referimos cuando hablamos de “código genético”?.
Explica por qué se caracteriza al código genético como universal y degenerado.
Define codón y anticodón.
El siguiente texto refiere a las tres etapas que caracterizan al proceso de
traducción. Completa según corresponda utilizando los términos ofrecidos a
continuación.
Aminoácido iniciador/ Peptidil transferasa/ A /Codón de iniciación /Factor de
elongación / Anticodón / Menor / ARNm / Factores de liberación / Codón de
terminación / Menor / Peptídico / Factores de iniciación.
1)
2)
3)
4)
La síntesis de proteínas puede dividirse en tres etapas:
Iniciación:
La síntesis de proteínas comienza cuando la subunidad __________del
ribosoma se une al extremo 5’ del ________. Para que ello ocurra, se requieren de
proteínas que se localizan en la subunidad menor y se conocen como _____________.
La subunidad _____________ se desliza sobre el ARNm, hasta localizar el
_________________ que quedará ubicado en el sitio P. Luego, el primer ARNt se
aparea por su _____________, en forma antiparalela, con el codón de iniciación. En el
dominio opuesto al anticodón, el ARNt porta el ______________ que será el primero
que conformará la proteína. Mediante ésta unión (codón - anticodón) quedará
establecido el marco de lectura de los sucesivos codones.
Posteriormente, se liberan los factores de iniciación y la subunidad ribosómica mayor
se acopla a la subunidad menor.
Elongación:
La elongación comienza cuando un segundo ARNt ingresa al sitio _____
del ribosoma, de acuerdo a la secuencia establecida por el ARNm. Pero, para que ello
ocurra, éste segundo ARNt debe unirse primero a una proteína conocida como
_____________ que, luego de la unión, se libera.
Cuando los dos sitios A y P ya han sido ocupados por los correspondientes ARNt, una
enzima denominada _________________ localizada en la subunidad mayor, cataliza la
formación de un enlace __________ entre los dos aminoácidos. Posteriormente, el
primer ARNt se libera y el ribosoma se corre dejando el sitio A libre para el ingreso de
un tercer ARNt.
Terminación:
Cuando el ribosoma alcanza un _______________, no existe ningún
ARNt cuyo anticodón pueda aparearse con estos codones. De esta manera, el sitio A
quedará vacío y es ocupado rápidamente por __________________, se detiene la
traducción, el polipéptido se desprende y se separan las dos subunidades ribosómicas.
5) Resuelve los siguientes problemas de opción múltiple:
a) Un RNA mensajero tiene 336 nucleótidos de longitud, incluyendo los codones
de iniciación y terminación. El número de aminoácidos de la proteína traducida
a partir de este ARNm es:
- 999
- 630
- 330
- 111
- 110
b) ¿Qué ARNm codifica para la siguiente proteína?
Met-Arg-Ser-Leu-Glu.
- 3´AUGCGUAGCUUGGAGUGA 5´
- 3´AGUGAGGUUCGAUGCGUA 5´
- 5´AUGCGUAGCUUGGAGUGA 3´
- 1´AUGCGUAGCUUGGAGUGA 3
- 3´AUGCGUAGCUUGGAGUGA 1´
c) Bajo condiciones donde La Metionina debe ser el primer aminoácido, ¿Qué proteína
estará codificada por el siguiente ARNm?
5´- CCUCAUAUGCGCCAUUAUAAGUGACACACA – 3´
-
Pro – His – Met – Arg – His – Tyr – Lys – Cys – His – Thr.
Met – Arg – His – Tyr – Lys – Cys – His – Thr
Met – Arg – His – Tyr - lys
Met - Pro – His – Met – Arg – His – Tyr – Lys – Cys – His – Thr
d) Se usa un ARNm sintético de secuencia repetitiva 5´- CACACACACACACA.....
en un sistema sintetizador de proteínas, en ausencia de células. Asumiendo que la
síntesis de proteínas pueda comenzar sin la necesidad de un codón de iniciación ¿Qué
producto o productos pueden esperarse tras la síntesis de proteínas?
- Una proteína compuesta por un solo tipo de aminoácido.
- Tres proteínas, cada una compuesta por un único tipo de aminoácido diferente.
- Dos proteínas, cada una con una secuencia alternada de dos aminoácidos
diferentes.
- Una proteína, con una secuencia de tres aminoácidos alternantes diferentes.
- Una proteína, con una secuencia de dos aminoácidos alternantes diferentes.
Descargar

Trabajo práctico: código genético y síntesis de proteínas

LA TRADUCCIÓN

LA TRADUCCIÓN

Proceso traslocaciónPolipétidosElongaciónARNmAnabolismoARNtEsquema

La síntesis de proteínas.

La síntesis de proteínas.

ADN (Ácido Desoxirribonucleico)TranscripciónAminoácidosCompuesto OrgánicoBiologíaQuímicaEstructura y funciónCódigo genético

Las influencias de los presocráticos

Las influencias de los presocráticos

DemócritoAnaxímenesPitágorasHeráclitoFuegoAlmaAnaximandroFilosofía clásicaLogosParménidesTales de MilatoEmpédoclesAnaxágoras

BIOLOGÃ A ESTRUCTURA Y FUNCION DE LAS PROTEINAS

BIOLOGÃ A ESTRUCTURA Y FUNCION DE LAS PROTEINAS

ADN (Ácido Desoxirribonucleico)ProteínasCadenas de ADNBiologíaARN (Ácido ribonucleico)Código genético

Síntesis de proteínas

Síntesis de proteínas

LigasaADN (Ácido Desoxirribonucleico)HelicasaRetículo endoplásmicoCebadorNúcleoBiologíaARN (Ácido ribonucleico)Aparato de GolgiDNA PolimerasaCélulasMetabolismo

Expresión de la información genética

Expresión de la información genética

AminoácidosProteínasGenéticaDescodificación del ADN (Ácido Desoxirribonucleico)Transferentes

Proteínas: Síntesis

Proteínas: Síntesis

TranscripciónRibosomasPéptidoQuímicaEnlace peptídicoBioquímicaCódigo genético