LABORATORIO AVANZADO
DE FISIOLOGÍA VEGETAL
Curso 2006-2007
MÓ
ÓD
DU
UL
LO
OD
DE
EC
CU
UL
LT
TIIV
VO
O IIN
NV
VIIT
TR
RO
O
Comisión Docente de Fisiología Vegetal
Departamento de Biología
Universidad Autónoma de Madrid
Francisca F. del Campo
Soledad Sanz Alférez
Luis E. Hernández
Módulo de Cultivo in vitro
CULTIVO IN VITRO DE EXPLANTOS DE TABACO.
ANÁLISIS DE TRANSGENICIDAD
Introducción
Diversas plantas de interés agroalimentario, ornamental o manipuladas genéticamente,
han de propagarse o regenerarse vegetativamente. Asimismo, en algunos casos es
preciso emplear técnicas de propagación vegetativa para erradicar infecciones por virus
y para introducir variaciones genotípicas que aumenten la calidad de los productos.
Estas técnicas se conocen genéricamente como cultivo in vitro.
Para el cultivo in vitro de células, tejidos u órganos hay una serie de factores que hay
que tener en cuenta. El medio de cultivo debe tener los nutrientes necesarios para que
las células vegetales puedan desarrollarse con normalidad: sales inorgánicas, una fuente
de carbono en el caso de no poder realizar fotosíntesis, vitaminas en algunos casos y
fitohormonas.
El medio inorgánico más empleado es la mezcla de sales diseñada por Murashige y
Skoog (MS). Este medio se puede completar con glucosa, vitaminas, auxinas y/o
citoquininas para el cultivo de distintos tipos de tejidos y células.
En la práctica vamos a preparar un medio de cultivo para la obtención de callos de
explantos de plantas de tabaco. Prepararemos medios de cultivo con distintas relaciones
de auxina/citoquinina que determinan, según los casos, mayor desarrollo de la parte
aérea o mayor desarrollo de la raíz.
Fig. 1. Diferenciación de explantos en función de distintas concentraciones de auxina y citoquinina
Laboratorio Avanzado de Fisiología Vegetal
1
Módulo de Cultivo in vitro
Kinetina
Zeatina
BAP: bencilaminopurina
Fig. 2. Estructuras moleculares de diversas auxinas y citoquininas empleadas para la preparación
de medios de cultivo in vitro.
Una de las aplicaciones del cultivo in vitro, como se ha indicado, es la regeneración de
plantas trasngénicas. Dado que los eventos de transformación genética solo afectan a
unas pocas células del material vegetal manipulado, es preciso incluir un GEN DE
SELECCIÓN. Esto es: un gen que codifica una enzima capaz de detoxificar una
sustancia letal para las células vegetales. Así, muchas plantas transgénicas portan como
gen de selección el gen de resistencia a los antibióticos kanamicina y neomicina
(neomicina fosfotransferasa, nptII). La presencia de este gen de selección o resistencia
se puede detectar en las plantas de tabaco cultivadas mediante dos experimentos: i)
propagación del material vegetal en un medio de cultivo in vitro suplementado con
kanamicina, y ii) detección del transgen mediante PCR a partir de DNA genómico.
Laboratorio Avanzado de Fisiología Vegetal
2
Módulo de Cultivo in vitro
NOTA IMPORTANTE:
Hay que evitar en lo posible la contaminación de los medios de cultivo por bacterias u
hongos. Es preciso trabajar en las mayores condiciones de esterilidad posibles.
Se trabajará muy cerca de la llama del mechero Bunsen, con la mesa de trabajo MUY
LIMPIA, evitando remover el aire alrededor de las placas en exceso. Hay que limpiarse
bien las manos con jabón y posteriormente se deben enjuagar con etanol 70 %.
SI NO CUIDAIS ESTE ASPECTO OS PODEIS ENCONTRAR CON VUESTRO
EXPERIMENTO
TOTALMENTE
INFECTADO
POR
ORGANISMOS
INDESEABLES!!!!
Asimismo, es necesario ser muy pulcros al esterilizar el material vegetal que se va a
cultivar in vitro. Por favor, seguid muy atentamente las indicaciones del guión de
prácticas y las recomendaciones que hagan los profesores.
1ª PARTE:
Propagación de plantas de tabaco tipo silvestre y
transgénicas en medio con kanamicina
1.1. Material para el cultivo in vitro
Material vegetal
Plantas cultivadas en un substrato orgánico. Se emplearán plantas que han sido
previamente cultivadas en nuestro laboratorio de tabaco (Nicotiana tabacum), de las que
disponemos una línea silvestre (no manipulada genéticamente) y otra transgénica (que
sobreexpresa un gen que codifica MnSOD). Estas plantas se crecieron en un substrato
de turba más perlita durante mes y medio.
Disoluciones para esterilizar los tejidos
De lavado: etanol 70%
Esterilizadora: hipoclorito sódico 20%, Tween-20 0.2 ml·L-1
Medio de cultivo básico
Medio MS: Es un preparado comercial que contiene las distintas sales mezcladas y listas
para ser disueltas en medio líquido. Cuando se disuelven en la cantidad adecuada, la
concentración final de los distintos nutrientes minerales es la mostrada en la Tabla 1.
Tabla 1. Concentración de sales minerales de la disolución nutritiva diseñda por Murashige-Skoog
Sales de macronutrientes (mg·L-1)
Sales de micronutrientes (mg·L-1)
NH4NO3
1650 KI
0.83
KNO3
1900 H3BO3
6.2
CaCl2·2H2O
440 MnSO4·4H2O
22.3
MgSO4·7H2O
370 ZnSO4·7H2O
8.6
KH2PO4
170 Na2MoO4·2H2O
0.25
CuSO4·5H2O
0.025
CoCl2·6H2O
0.025
Na2·EDTA
37.3
Laboratorio Avanzado de Fisiología Vegetal
3
Módulo de Cultivo in vitro
FeSO4·7H2O
27.8
Dicho medio básico hay que suplementarlo con diversos componentes. Las vitaminas
están preparadas en disoluciones concentradas stock, que, al ser termolábiles, se
esterilizan por filtración:

Vitaminas (termolábiles, STOCK 1000 v.c.):
1. Ácido nicotínico 5 mg·L-1
2. Tiamina hidrocloruro 5 mg·L-1
3. Piridoxina hidrocloruro 1 mg·L-1



Mio-inositol 1 g·L-1
Sacarosa 3 %
Para medio sólido: agar (Phytogel, Sigma) 0.8 %
Medio de cultivo con fitohormonas y kanamicina
Para comprobar el efecto de una aplicación exógena de hormonas sobre el desarrollo del
explanto vamos a preparar distintos medios de cultivo, donde la concentración de
fitohormonas será distinta, siguiendo el esquema de la Tabla 2. Se parte de disoluciones
stock concentradas, que se añadirán para preparar 500 mL de medio por grupo. Este
volumen de medio es suficiente para preparar al menos 20 placas Petri por grupo.



Auxina (termolábil, STOCK 1000 v.c.): ácido naftalénacético (NAA) 3 g·L-1
Citoquinina (termolábil, STOCK 1000 v.c.): bencilaminopurina (BAP) 1 g·L-1
Kanamicina (termolábil, STOCK 1000 v.c.): 50 g L-1
Tabla 2. Medios de cultivo a preparar por los distintos grupos de trabajo, en los que se variará la
proporción de fitohormonas y la presencia o ausencia de kanamicina. Los volúmenes de los stock de
fitohormonas se han calculado para preparar 500 mL de medio de cultivo.
Medio
Kan
Conc. final (mg·LNA
1)
A
auxina:citoquinina
BAP
Kan Grupo
(µL)
(mg L-1)
Alta auxina (AA)
NO
3.0 : 0.0
500
0
0
1
Media aux. (MA)
NO
1.5 : 0.5
250
250
0
2
Baja aux. (BA)
NO
0.5 : 3.0
85
1500
0
3
AA + kanamicina
50
3.0 : 0.0
500
0
500
4
MA + kanamicina
50
1.5 : 0.5
250
250
500
5
BA + kanamicina
50
0.5 : 3.0
85
1500
500
6
Laboratorio Avanzado de Fisiología Vegetal
4
Módulo de Cultivo in vitro
Aparatos, instrumental y material vario
Autoclave
Pinzas y bisturíes
Placas Petri estériles
Pipetas automáticas
Fitotrón (22ºC-17ºC, 16h
Puntas pipetas estériles
luz-8h oscuridad)
pHmetro
Tijeras
Mechero Bunsen
Balanza
Pulgas magnéticas
Agitador magnético
Tubos Falcon
Frascos ISO de 1 L
1.2. Metodología cultivo in vitro
DIA 1
Se prepararán las placas con medio de cultivo sólido. En primer lugar se procederá a la
preparación de 500 mL de medio de cultivo líquido MS por grupo (Cada mesa tendrá los
cuatro tratamientos indicados). Las sales inorgánicas (macronutrientes y
micronutrientes) vienen mezclados en un preparado comercial (Sigma, M-5524). En un
vaso de precipitado que contenga aproximadamente 400 mL de H2O desionizada, se
disuelven 2.15 g del preparado comercial. Seguidamente se añaden 15 g de sacarosa y
0.5 g de mio-inositol. Una vez disueltos los solutos, la disolución se ajusta a pH 6.0 y se
enrasa el volumen a 500 mL. En una botella de 1 L (Duran, tapón azul) se echan 4 g de
Phytogel y se vierte con cuidado los 500 mL del medio que se ha preparado. Se
autoclavan en ciclo corto 121ºC a 105 kPa durante 20 min.
Una vez autoclavados los medios, se tienen que enfriar hasta alcanzar unos 60ºC. Esta
temperatura permite coger los matraces con la mano, NO TIENEN QUE QUEMAR
AL TACTO. Cuando ha alcanzado la temperatura adecuada, se procede a la adición de
los componentes termolábiles que han sido esterilizados previamente por filtración. Se
añaden los correspondientes volúmenes de las disoluciones stock: vitaminas 0.5 mL,
fitohormonas o kanamicina según se indica en la Tabla 2. SIEMPRE CUIDANDO DE
TRABAJAR MUY CERCA DEL MECHERO ENCENDIDO, MANTENIENDO
LA BOCA DE LA BOTELLA CERCA DE LA LLAMA, Y SIEMPRE
TRABAJAR CON LA MAYOR PRESTEZA POSIBLE.
Una vez añadidos los componentes necesarios, la botella se agita por rotación para
homogeneizar la mezcla, y con la mayor presteza hay que plaquear antes de que se
solidifique el agar.
Se prepararán 15-20 placas Petri con los 500 mL de medio de cultivo estrilizado. HAY
QUE EVITAR DEJAR LAS PLACAS ABIERTAS. CUANTO MÁS CUIDADO
SE PONGA EN ESTE PASO, MENOS PROBLEMAS DE CONTAMINACIÓN
HABRÁ.
Las placas se dejan solidificar, se cierran con una tira de Prafilm y ya estarán listas para
el día siguiente.
Laboratorio Avanzado de Fisiología Vegetal
5
Módulo de Cultivo in vitro
DIA 2
Se procederá a recolectar los tejidos a cultivar in vitro de plantas de tabaco silvestre y
transgénico. Se cortarán secciones de tallo y hojas con bisturí, que seguidamente se
transferirán a tubos Falcon de 50 mL para su esterilización.
Esterilización
Se añade 15-20 mL de etanol 70%, agitando suavemente durante 3 min. Se enjuaga el
tejido con agua estéril y se lava el tejido con otros 15-20 mL de la disolución
esterilizadora durante 5 min. Para eliminar la lejía, se lava el tejido con tres volúmenes
de H2O desionizada estéril, TRABAJANDO SIEMPRE CERCA DEL MECHERO.
MUCHO, MUCHO CUIDADO CON EL ETANOL Y EL MECHERO.
ES ALTAMENTE INFLAMABLE Y NO QUEREMOS TENER
BAJAS EN LA TROPA!!
Una vez esterilizado el tejido, y TRABAJANDO CON PRESTEZA Y MUCHO
CUIDADO, se cortarán más finamente los tallos en secciones de aproximadamente 0,5
cm de espesor. Seguidamente, se transfieren a las placas Petri con unas pinzas que
hayan sido flameadas, apoyando los sectores sobre el agar. Finalmente, las placas hay
que sellarlas con Parafilm.
POR FAVOR, INSISTIMOS EN EL CUIDADO QUE DEBEIS
TENER PARA QUE SE TRABAJE CON LA MAYOR LIMPIEZA Y
ESTERILIDAD POSIBLES
Dejaremos el material en el Fitotrón. Cada 5-7 días se observará el progreso del
experimento, y cuando pasen 3-4 semanas podremos observar el desarrollo final de los
explantos, a los que se tomarán fotografías.
Laboratorio Avanzado de Fisiología Vegetal
6
Módulo de Cultivo in vitro
2ª PARTE:
Detección de transgenes de resistencia a kanamicina
mediante PCR en plantas transgénicas de tabaco
2.1. Fundamento del experimento
De las diversas técnicas disponibles para detectar la presencia de un transgen hemos
optado por emplear la reacción en cadena de la polimerasa (PCR), por ser una de las
más sencillas. No obstante, se ha de disponer de información previa sobre la secuencia
del gen o genes que se han incluido en el genoma de la planta para poder diseñar los
cebadores específicos correspondientes (ver anexo con las secuencias).
Fig. 3. Esquema de amplificación de un fragmento de DNA genómico utilizando la reacción en
cadena de la polimerasa (PCR).
Laboratorio Avanzado de Fisiología Vegetal
7
Módulo de Cultivo in vitro
El procedimiento consiste en la extracción de DNA de hojas de plantas de tabaco, tipo
silvestre o NO transgénicas (WT), y de plantas transgénicas (MnSOD) que portan un
gen de selección de kanamicina (nptII). Para ello se utilizará el kit comercial Nucleon
Phytopure (Amersham Biosciences/GE Healthcare, Reino Unido). El DNA obtenido se
utilizará como molde de reacciones de PCR que se prepararán con cebadores específicos
mostrados en la Tabla 3. Tras realizar la reacción de PCR en un termociclador, los
productos de amplificación se visualizarán mediante una electroforesis en gel de agarosa
y con tinción de bromuro de etidio (SUBSTANCIA CARCINOGÉNICA QUE HAY
QUE MANIPULAR CORRECTAMENTE).
2.2. Metodología PCR de DNA genómico
DIA 1
Extracción de DNA
Cada grupo coge hojas de un solo tipo de plantas: grupos impares (1, 3 y 5) de las
plantas silvestres (WT); y grupos pares (2, 4 y 6) de las plantas transgénicas
(MnSOD). Las hojas se congelan y homogeneizan con ayuda de un mortero en
nitrógeno líquido (N2(l)). Será suficiente con coger 4 o 5 trozos grandes de hoja. Una
vez obtenido un polvo congelado homogéneo, se transfieren 0,1 g a un tubo
Eppendorf de 1.5 mL estéril, que previamente contiene 600 µL del tampón de
homogeneización o REAGENT 1 (Nucleon Phytopure, Amersham Biosciences). Se
mezcla bien con varias inversiones del tubo y se añaden 200 µL del tampón de dilución
o REAGENT 2. Se invierte el tubo nuevamente varias veces hasta obtener una mezcla
homogénea. Seguidamente se incuba a 65ºC durante 10 min con varias agitaciones
manuales. Ubicar el tubo en un baño de hielo durante 20 min.
Para eliminar el DNA de impurezas se añaden 500 µL de cloroformo y 100 µL de la
Resina de Extracción Nucleon. ESTA ÚLTIMA, SERÁ DISPENSADA POR LOS
PROFESORES. Se mantienen los tubos a temperatura ambiente durante 10 min, y con
agitación suave periódica. Seguidamente se centrifugan los tubos a 12000 g, 4ºC durante
5 min. Se toman 600 µL del sobrenadante SIN REMOVER LA INTERFASE CON LA
RESINA. Es MUY importante que los tubos una vez centrifugados se manipulen con
SUAVIDAD, para no volver a mezclar las fases y la resina.
Por último, se procede a precipitar el DNA purificado añadiendo 1 volumen (600 µL)
de isopropanol frío (estará almacenado a -20ºC), invirtiendo suavemente el tubo hasta
que el DNA precipita. A continuación se centrifugan el tubo a 12000 g durante 5 min
para sedimentar el DNA. Se elimina con cuidado el sobrenadante y el precipitado de
DNA se lava dos veces con 300 µL de etanol 70% frío (mantenido en baño de hielo).
Para evitar que flote el precipitado de DNA hay que centrifugar a 12000 g durante 2 min
entre lavados. Para no perder el DNA, lavar el precipitado y eliminar los sobrenadantes
con las pipetas de 200 µL (puntas amarillas). Dejar secar el DNA al aire, y cuando esté
seco (esperar 10-15 min) se redisuelve el DNA en 25 µL de agua MiliRO estéril.
Previamente a la realización de la reacción de PCR, se diluye el DNA 1/5 (10 µL de la
muestra más 40 µL de H2O) para tener la muestra molde preparada.
Laboratorio Avanzado de Fisiología Vegetal
8
Módulo de Cultivo in vitro
Tabla 3. Cebadores específicos diseñados para amplificar distintos fragmentos de DNA,
junto con el tamaño esperado del fragmento y la temperatura de anillamiento.
Cebadores específicos utilizados
Fragmento
Cebador positivo
Cebador negativo
Tª ani.
Rubisco
(349 pb)
tccctgtttcaaggaagc
Rbcs01F
gtcgcataaaattgaaggag
Rbcs02R
59
nptII
(317 pb)
gaagagcatcaggggctc
nptII01F
gaagaactcgtcaagaaggc
nptII02R
59
35S
(234 pb)
tgccatcattgcgataaagg
35S01F
cctctccaaatgaaatgaac
35S02R
59
Nos term
(127 pb)
gaatcctgttgccggtcttgcg
nos01F
gcgggactctaatcataaaaac
nos02R
62
Reacción de PCR
Los profesores elaborarán una mezcla maestra (tubo MM) que contendrá todos los
componentes de la mezcla de reacción de la PCR excepto el molde de DNA (obtenido
por cada grupo) y los cebadores específicos de cada fragmento a amplificar. Para cada
tubo de PCR (utilizar los tubos especiales de 200 µL de pared fina estériles), se
deben poner los siguientes componentes en la MM para un volumen de reacción final de
50 µL: tampón de polimerasa 10X (ya contiene Mg2+), 5 µL; 1 unidad de Taq
polimerasa (5 U/µL), 0,2 µL; dNTPs 10 mM (conc. final 200 µM), 2 µL; H2O, 27,8 µL.
A los 35 µL de MM hay que añadir 5 µL de cada cebador (total 10 µL para la pareja) y 5
µL del molde de DNA. En la Tabla 4 se describen los componentes que hay que añadir
en cada uno de los 8 tubos de PCR que cada grupo ha de preparar.
Dado que cada grupo ha extraído DNA de una sola planta, se compartirá por mesa
ambos moldes para que TODOS LOS GRUPOS ENSAYEN TODAS LAS
COMBINACIONES (Tabla 4).
Una vez mezclados los componentes de la reacción de PCR se introducen los tubos en el
termociclador y se someten al siguiente programa:
Temperatura (ºC)
Tiempo
94
5 min
Desnaturalización
94
1 min
Anillamiento
59
45 s
Extensión
74
45 s
 Extensión final
74
5 min
 Final reacción
10
Hasta el siguiente día
 Desnaturalización
 40 ciclos
Laboratorio Avanzado de Fisiología Vegetal
9
Módulo de Cultivo in vitro
Tabla 4. Componentes de la mezcla de reacción para la amplificación de fragmentos de
DNA genómico mediante PCR.
Combinación de componentes del medio de reacción de PCR genómico
CEBADOR 10 µM (µL)
WT
MnSOD
Molde de DNA
5
5
Tubos Nº
1
2
Molde de DNA
5
5
Tubos Nº
3
4
Molde de DNA
5
5
Tubos Nº
5
6
Molde de DNA
5
5
Tubos Nº
7
8
35S
nptII
Rubisco
Componente
Nos termin
Rubisc
o
Rbcs01F
5
Rbcs02R
5
nptII
nptII01F
5
nptII02R
5
35S
Molde de DNA (µL)
35S01F
5
35S02R
5
Nos termin
nos01F
5
nos02R
5
Mezcla Maestra (µL)
35
35
35
35
35
35
TOTAL (µL)
50
50
50
50
50
50
DIA 2
Análisis de la PCR: separación de los fragmentos en gel de agarosa
Los nucleótidos se separarán mediante electroforesis no desnaturalizante en gel de
agarosa 2% en tampón TAE (40 mM Tris-acetato, 1 mM Na2EDTA, pH 8.0). Las
bandas correspondientes al cDNA amplificado se visualizarán en un transiluminador
con luz ultravioleta teñidos con bromuro de etidio (BrEt).
Laboratorio Avanzado de Fisiología Vegetal
10
Módulo de Cultivo in vitro
Reactivos para la electroforesis de DNA
Tampón TAE. Madre 50x
Volumen de 1 L
Tris base
242 g
Ácido acético glacial
57.1 mL
Disolución 0.5 M EDTA pH 8.0
100 mL
Tampón TAE de trabajo
Dilución 1/50 del anterior
Disolución de carga de muestras, preparada en H2O miliRO
Bromofenol azul
0.25%
Xilencianol
0.25%
Glicerol
30%
Disolución madre de BrEt
10 mg/mL
Escalera de DNA de 100 pb, preparada directamente para cargar
En un matraz cónico de 250 mL limpio se pesan 2 g de agarosa y se añaden 100 mL del
tampón TAE. Se pone a calentar en un horno microondas hasta conseguir la disolución
de todo el agarosa, agitando suavemente hasta que desaparezcan los grumos.
PRECAUCIÓN: el agarosa fundido puede estar a muy alta temperatura. Se ruega trabar
con extremo cuidado para evitar quemaduras.
Cuando la agarosa no queme al tacto (el calor soportable normal es aproximadamente de
60ºC), se añaden 4 µL de la disolución madre de BrEt. Temperaturas superiores pueden
hacer que se degrade, y posteriormente no veríamos nada. PRECAUCIÓN: el bromuro
de etidio es altamente carcinogénico. HAY QUE MANIPULARLO CON MUCHO
CUIDADO, siempre usando guantes, y desprendiéndose de los residuos (puntas de
pipeta, cintas, guantes, etc.) en el contenedor destinado a ello. NO TIRAR NADA
CONTAMINADO A LA BASURA NORMAL.
Una vez que el gel se ha solidificado se pone en la cubeta de electroforesis, se cubre
suficientemente con TAE y se cargan las muestras. Para ello, se usan 15 µL del medio
de reacción de PCR a los que se ha añadido 2 µL de disolución de carga. CON
CUIDADO DE NO PERFORAR EL POCILLO DE AGAROSA, se transfieren 15 µL a
cada pocillo.
Finalizado el proceso de carga, se conectan los cables a la fuente de electroforesis. Se
enciende el equipo, se ponen a correr a 70 V y se espera aproximadamente 30 min para
que se separen los colorantes añadidos a la muestra.
Por último, se visualiza el gel en el transiluminador de luz ultravioleta y, si ha habido
reacción de PCR se toma una foto con la cámara digital. El resultado será, esperemos,
similar a lo mostrado en la Fig. 4.
Laboratorio Avanzado de Fisiología Vegetal
11
Módulo de Cultivo in vitro
Fig. 4. Amplificación por PCR de diversos fragmentos de DNA, utilizando como molde DNA
genómico obtenido de plantas no transgénicas (WT) y plantas transgénicas (MS) de tabaco. Se
muestran los resultados empleando cebadores contra la subunidad pequeña de Rubisco (control
positivo) y el de dos componentes de un transgen: gen de resistencia a kanamicina (nptII) y contra el
promotor CaMV35S (utilizado para conseguir un nivel constante de expresión de un gen). En el
carril L se muestra la escalera de DNA de100 pb, que permite determinar el tamaño de los
fragmentos amplificados (L).
Laboratorio Avanzado de Fisiología Vegetal
12
Descargar

Cultivo in vitro (LAFV) - Universidad Autónoma de Madrid

Fisiología vegetal y biología animal

Fisiología vegetal y biología animal

RespiraciónFósforoFotosíntesisInsectosPlantasMamíferosTetrazolioTranspiraciónNitrógeno

EXAMEN DE BIOLOGÍA MOLECUL4R GRUPO A JUNIO−99

EXAMEN DE BIOLOGÍA MOLECUL4R GRUPO A JUNIO−99

Proceso de replicaciónFarmaciaTraducción en ProcariotasReplicación de los genesProblema TeloméricoDNA PolimerasaRNA Polimerasa

Los ácidos nucleicos

Los ácidos nucleicos

Ácido fosfóricoTeoría de las proteínasMecanismos molecularesSoporte molecularEstructura química de los genesNucleótidosPolímerosDNA (Deoxyribonucleic Acid)Biología celularInformación genética

Material genético

Material genético

ADN (Ácido Desoxirribonucleico)CromosomaCélulaEstructuraOrganización

Papilomavirus

Papilomavirus

ADN (Ácido Desoxirribonucleico)VirusEnfermedades víricasTratamientoVPHPropiedadesPrevención

Sistema glandular interno

Sistema glandular interno

MitosisCitologíaOsmosisReproducción asexualHormonasCélulasEstructura genética